Syntrichia caninervis

From ICG
Jump to: navigation, search

Description

Syntrichia caninervis.png
  • Syntrichia caninervis is a desert moss and the dominant bryophyte of the biological soil crusts found in the Gurbantunggut desert of Northwestern China. The extreme desert environment is characterized by prolonged drought, temperature extremes, high radiation and frequent cycles of hydration and dehydration. S. caninervis has gained particular attention due to its extreme desiccation tolerance. It is an ideal organism for the identification and characterization of genes related to abiotic stress tolerance[1] [2].
  • NCBI Taxonomy

Abiotic Stress and Desiccation/Rehydration

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
α-TUB2[1] Alpha-tubulin
  • Hydration-desiccation-rehydration process
KJ398824
  • F:CGGTCATTACACCGTGGGAA
  • R:CCTCTCCAGCAACAGCGAA
154 60 SYBR
TUB1[1] Alpha-tubulin
  • Abiotic stress treatments
KJ398823
  • F:CGTCGTCTATGATGGCGAAGT
  • R:TCTTGATCGTTGCCACTGCC
117 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Daoyuan Zhang
  • Email: zhangdy@ms.xjb.ac.cn
  • Institution: Key Laboratory of Biogeography and Bioresource in Arid Land, Xinjiang Institute of Ecology and Geography – Chinese Academy of Sciences, Ürümqi, China

Citation Statistics

Cited by 14 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Li X, Zhang D, Li H, et al. (2015) Characterization of reference genes for RT-qPCR in the desert moss Syntrichia caninervis in response to abiotic stress and desiccation/rehydration. Front Plant Sci 6, 38.
  2. Zhang J, Zhang YM, Downing A, Wu N, Zhang BC (2011) Photosynthetic and cytological recovery on remoistening Syntrichia caninervis Mitt., a desiccation-tolerant moss from Northwestern China. Photosynthetica 49, 13-20.

Categories