Anthurium andraeanum

Description

• Anthurium andraeanum (Hort.) is an ornamental crop cultivated for its cut-flower, which is commercially second only to orchids among tropical flowers. The cut-flower consists of a protruding inflorescence called the spadix that is subtended by a modified leaf called the spathe. The spathe is usually brilliantly colored and heart-shaped and is the more attractive part of the cut-flower.
• Common Name: Tailflower, Flamingo flower, Laceleaf
• NCBI Taxonomy

Spathe Tissue

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
CYP	Cyclophilin	Spathe tissues Different cultivars, color groups, developmental stages and harvesting times	JN602201	F:GGCAAGCCCCTCCACTACAA R:GCCCTGGCACATGAACTGGG	65	60	SYBR
UBQ5	Ubiquitin-like protein 5	Spathe tissues Different cultivars, color groups, developmental stages and harvesting times	JN602199	F:TCCGCATCCAGAAGTGGTAC R:TGCCGTCGTGGATCTCGTAG	72	60	SYBR

Molecular Types

• mRNA

Evaluation Methods

• geNorm method && Related Reference
• NormFinder method && Related Reference

Contact

• Name: Pathmanathan Umaharan
• Email: pumaharan@sta.uwi.edu
• Institution: Department of Life Sciences, Faculty of Science and Technology, The University of the West Indies, St. Augustine Campus, College Road, Republic of Trinidad and Tobago

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-09-01])