Dendrocalamus latiflorus

Description

• Dendrocalamus latiflorus, an evergreen species locally known as ‘tropical giant bamboo’, distributes widely in southern China and southeast Asia and plays vital roles as valuable natural resources. It is a unique member of the monophyletic BEP clade (Bambusoideae, Ehrhartoideae, Pooideae) in grass family (Poaceae), comprise various woody and herbaceous varieties. Woody bamboos are arborescent and perennial plants characterized by remarkable sizes, woodiness and rather striking life history, which also endow it with considerable economic and environmental significance.
• Common Name: Taiwan giant bamboo, Sweet bamboo
• NCBI Taxonomy

Different Tissues & Ploidy

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
GAPDH	Glyceraldehyde 3-phosphate dehydrogenase	Seeds, flowers， leaves, stem, and root	KF484750	F:CCGTCAACGACCCCTTCATCACC R:TACTCAGCACCAGCCTCAGCCCA	193	60	SYBR
EF1a	Elongation factor 1-alpha	Seeds, flowers， leaves, stem, and root	KF484749	F:GTTGTTACCTTTGGTCCCAGCGG R:TGGCAGGGTCATCCTTGGAGTTG	175	60	SYBR

Molecular Types

• mRNA

Evaluation Methods

• geNorm method && Related Reference
• NormFinder method && Related Reference
• BestKeeper method && Related Reference

Contact

• Name: Renying Zhuo
• Email: zhuory@gmail.com
• Institution: State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing, People's Republic of China, 2 The Research Institute of Subtropical Forestry, Chinese Academy of Forestry, Fuyang, People's Republic of China

Citation Statistics

Cited by 8 (Based on Google Scholar [2017-09-01])