Talaromyces marneffei

From ICG
Jump to: navigation, search

Description

Talaromyces marneffei-1.jpg
  • Talaromyces marneffei (or Penicillium marneffei) is an opportunistic pathogen that can cause disseminated disease in human immunodeficiency virus (HIV)-infected patients, especially in Southeast Asia. T. marneffei is a thermally dimorphic fungus. Typically, T. marneffei has an adaptive morphology. It grows in a filamentous form (mould) at 25 °C and can differentiate to produce asexual spores (conidia). In contrast, at 37 °C, it grows as yeast cells that divide by fission [1].
  • Common Name: Unknown
  • NCBI Taxonomy

Specific Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
act[1] β-actin
  • Different cell types
  • All growth forms
NA
  • F:TGATGAGGCACAGTCTAAGC
  • R:CTTCTCTCTGTTGGACTTGG
155 61~63 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Nongnuch Vanittanakom
  • Email: NA
  • Institution: Department of Microbiology, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 Dankai W, Pongpom M, Vanittanakom N. Validation of reference genes for real-time quantitative RT-PCR studies in Talaromyces marneffei. J Microbiol Methods. 2015 Nov;118:42-50.

Categories