Tetranychus urticae

From ICG
Jump to: navigation, search

Description

Tetranychus urticae.png
  • Tetranychus urticae Koch is one of the most important pest species worldwide. It can infest nearly 800 plant species, including peppers, tomatoes, potatoes, beans, maize, strawberries, and ornamental plants such as roses. Attacks by hundreds and thousands of spider mites can significantly reduce the photosynthetic capability of plants. The control of T. urticae has traditionally relied on synthetic insecticides and acaricides[1] [2].
  • Common Name: Red spider mite, Two-spotted spider mite
  • NCBI Taxonomy

Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PRL13[1] Ribosomal protein L13
  • Different developmental stages
JN881328
  • F:GCTCACAGCCTATGAAGGTATT
  • R:AGAACTTACGACCTCCTTGTAATC
90 55 SYBR
v-ATPase[1] Vacuolar-type H+-ATPase
  • Different developmental stages
DQ988698
  • F:CCCGAAGAGATGATCCAAACTG
  • R:CGGTAAACCTGATGCTGAGAAA
99 55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: S.K. Bhure
  • Email: sdbhure@rediffmail.com
  • Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India

Citation Statistics

Cited by 13 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Yang C, Pan H, Liu Y, Zhou X (2015) Stably expressed housekeeping genes across developmental stages in the two-spotted spider mite, Tetranychus urticae. PLoS One 10, e0120833.
  2. Lu W, Wang M, Xu Z, et al. (2017) Adaptation of acaricide stress facilitates Tetranychus urticae expanding against Tetranychus cinnabarinus in China. Ecol Evol 7, 1233-1249.

Categories