Tribolium castaneum

From ICG
Jump to: navigation, search

Description

Tribolium castaneum.png
  • Tribolium castaneum is a species of beetle in the family Tenebrionidae. It is a worldwide pest of stored products, particularly food grains. It has become an important insect model organism and pest beetle species for ethological and food safety research as well as for studies of developmental genetics, evolutionary developmental biology and insect immunity. Its genome has been fully sequenced[1][2].
  • Common Name: Red flour beetle
  • NCBI Taxonomy

Fungal Challenge

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPS18[1] Ribosomal protein S18
  • Exposed to Beauveria bassiana
XM_968539
  • F:CGAAGAGGTCGAGAAAATCG
  • R:CGTGGTCTTGGTGTGTTGAC
NA 55 SYBR
RPS3[1] Ribosomal protein S3
  • Exposed to Beauveria bassiana
XM_965494
  • F:ACCTCGATACACCATAGCAAGC
  • R:ACCGTCGTATTCGTGAATTGAC
NA 55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Brenda Oppert
  • Email: jeff.lord@ars.usda.gov
  • Institution: USDA-ARS, Grain Marketing and Production Research Center, 1515 College Avenue, Manhattan, KS 66502, USA

Citation Statistics

Cited by 74 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Lord J C, Hartzer K, Toutges M, et al. Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge[J]. Journal of microbiological methods, 2010, 80(2): 219-221.
  2. Strobl F, Klees S, Stelzer EHK.J Vis Exp. 2017 Apr 28;(122). doi: 10.3791/55629.PMID: 28518097.

Categories