Trifolium pratense

From ICG
Jump to: navigation, search

Description

Trifolium pratense.png
  • Trifolium pratense L. is an important forage legume widely cultivated in most temperate regions because of its characteristics of high seedling vigor, rapid growth, and tolerance to acidic and humid conditions. It is also used as a green manure crop because of its high nutrient content resulting partly from symbiosis with nitrogen fixing bacteria of the genus Rhizobium. It has a diploid genome (2n = 2x = 14), with a DNA content of 0.97 pg/2C,7 which is slightly larger than that of rice[1][2].
  • Common Name: Red clover
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
YLS8[1] Yellow-leaf-specific protein 8
  • Leaves, stems and roots
BB917276
  • F:CCCTTCCTTGCACCTCTGTA
  • R:CACCGGAAACAACAACAAGA
93 60 SYBR
UBC2[1] Ubiquitin-conjugating enzyme E2
  • Leaves, stems and roots
BB916552
  • F:TCCAAACCCAAACTCTCCAG
  • R:CTGCTCAACAATCTCGCGTA
97 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Khosro Mehdi Khanlou
  • Email: mehdikhanloo@yahoo.com
  • Institution: Department of Plant Production, Ghent University, Coupure Links 653, 9000 Ghent, Belgium

Citation Statistics

Cited by 29 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Khanlou K M, Van Bockstaele E. A critique of widely used normalization software tools and an alternative method to identify reliable reference genes in red clover (Trifolium pratense L.)[J]. Planta, 2012, 236(5): 1381-1393.
  2. Sato S, Isobe S, Asamizu E, et al. Comprehensive structural analysis of the genome of red clover (Trifolium pratense L.)[J]. DNA research, 2005, 12(5): 301-364.

Categories