Triticum aestivum

From ICG
Jump to: navigation, search

Description

Triticum aestivum.png
  • Triticum aestivum is the dominant crop in temperate countries being used for human food and livestock feed. Wheat is counted among the ‘big three’ cereal crops, with over 600 million tonnes being harvested annually. Wheat is unrivalled in its range of cultivation, from 67º N in Scandinavia and Russia to 45º S in Argentina, including elevated regions in the tropics and sub-tropics. The genetic relationships indicate that they originated from the south-eastern part of Turkey. Wheat contributes essential amino acids, minerals, and vitamins, and beneficial phytochemicals and dietary fibre components to the human diet[1][2][3][4].
  • Common Name: Wheat
  • NCBI Taxonomy

Rust Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ARF[1] ADP-ribosylation factor
  • P.triticina-infected wheat
AB050957
  • F:GCTCTCCAACAACATTGCCAAC
  • R:GCTTCTGCCTGTCACATACGC
165 60 SYBR
RLI[1] RNase L inhibitor-like protein
  • P.triticina-infected wheat
  • P.striiformis-infected wheat
AK331207
  • F:CGATTCAGAGCAGCGTATTGTTG
  • R:AGTTGGTCGGGTCTCTTCTAAATG
242 60 SYBR
CDC[1] Cell division control protein
  • P.graminis f.sp.tritici-infected wheat
  • P.striiformis-infected wheat
EU267938
  • F:CAAATACGCCATCAGGGAGAACATC
  • R:CGCTGCCGAAACCACGAGAC
227 60 SYBR
18S[1] 18S rRNA
  • P.graminis f.sp.tritici-infected wheat
AH001810
  • F:GTGACGGGTGACGGAGAATT
  • R:GACACTAATGCGCCCGGTAT
151 60 SYBR
TUBB[1] B-Tubulin
  • P.graminis f.sp.tritici-infected wheat
U76897
  • F:CAAGGAGGTGGACGAGCAGATG
  • R:GACTTGACGTTGTTGGGGATCCA
84 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jakobus J. Scholtz
  • Email: jjscholtz@gmail.com
  • Institution: Department Plant Sciences, University of the Free State, Nelson Mandela Road, Bloemfontein 9301, South Africa

Citation Statistics

Cited by 17 (Based on Google Scholar [2017-09-01])

Biotic & Abiotic Stress Treatments

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
mi167 [2] Mi167
  • Universal reference gene
MI0006174
  • F:CGCGATGAAGCTGCCAGCAT
  • R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGATC
NA 60 SYBR
mi159[2] Mi159
  • Universal reference gene
MI0006170
  • F:CGCGCTTTGGATTGAAGGGA
  • R:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGAGC
NA 60 SYBR

Molecular types

  • miRNA

Evaluation Methods

Contact

  • Name: Zhensheng Kang
  • Email: kangzs@nwsuaf.edu.cn
  • Institution: College of Plant Protection, Northwest A & F University, 712100, Yangling, Shaanxi, People’s Republic of China

Citation Statistics

Cited by 44 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Scholtz J J, Visser B. Reference gene selection for qPCR gene expression analysis of rust-infected wheat[J]. Physiological and molecular plant pathology, 2013, 81: 22-25.
  2. 2.0 2.1 2.2 Feng H, Huang X, Zhang Q, et al. Selection of suitable inner reference genes for relative quantification expression of microRNA in wheat[J]. Plant Physiology and Biochemistry, 2012, 51: 116-122.
  3. Feldman M. Smartt J, Simmonds NW. Wheats, Evolution of crop plants , 1995Harlow, UKLongman Scientific and Technical(pg. 185-192).
  4. Heun M, Schäfer-Pregl R, Klawan D, Castagna R, Accerbi M, Borghi B, Salamini F. Site of einkorn wheat domestication identified by DNA fingerprinting, Science , 1997, vol. 278 (pg. 1312-1314).

Categories