Tuber melanosporum

From ICG
Jump to: navigation, search

Description

Tuber melanosporum.png
  • Tuber melanosporum Vittad is a kind of symbiotic fungus, belongs to the Ascomycota and forms mutualistic symbiosis with tree and shrub roots. This truffle has a high value in a global market and is cultivated in many countries of both hemispheres. Due to its intense and complex aroma, T. melanosporum is considered the queen of truffles, and is one of the most highly praised and priced gourmet food worldwide. The publication of the T. melanosporum genome has given researchers a unique opportunity to learn more about the biology of the fungus[1] [2].
  • Common Name: Black truffle,black diamond of cuisine,Périgord black truffle
  • NCBI Taxonomy

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1A[2] Elongation factor 1-alpha
  • Universal reference gene
GSTUMT00000021001
  • F:AAGGGTGCCGAGTCTTTCAA
  • R:TATGAGCGGTGTGGCAGTCA
100 60 SYBR
G6PD[2] Glucose-6-phosphate dehydrogenase
  • Universal reference gene
GSTUMT00008696001
  • F:CGCGATGAGAAGGTCAGAGTT
  • R:CAGGCTTGCTGCCATCAAG
100 60 SYBR
18S[2] 18S ribosomal RNA
  • Universal reference gene
AM748736.1
  • F:CGCGATGAGAAGGTCAGAGTT
  • R:CAGGCTTGCTGCCATCAAG
100 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Osvaldo Zarivi
  • Email: osvaldo.zarivi@univaq.it
  • Institution: Department of Life, Health and Environmental Sciences, University of L'Aquila, 67100 L'Aquila, Italy

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-09-01])

References

  1. Campo E, Marco P, Oria R, Blanco D, Venturini ME (2017) What is the best method for preserving the genuine black truffle (Tuber melanosporum) aroma? An olfactometric and sensory approach. LWT - Food Science and Technology 80, 84-91.
  2. 2.0 2.1 2.2 2.3 Zarivi O, Cesare P, Ragnelli AM, et al. (2015) Validation of reference genes for quantitative real-time PCR in Perigord black truffle (Tuber melanosporum) developmental stages. Phytochemistry 116, 78-86.

Categories