Scophthalmus maximus

Description

Scophthalmus maximus is a flatfish that has been intensively cultured during the last decade due to its great commercial value. With 22 haploid chromosomes and one of the smallest genomes among cultured fishes (< 800 Mb), its production in Europe has increased from 3000 Tm in 1996 to 9246 Tm in 2009. As in many other cultured species, weight and length are traits of special interest. Size dispersion in turbot culture, mainly due to sexual dimorphism since females largely outgrow males, is another key issue for its farming^[1]^[2].
Common Name: Turbot
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
GAPDH^[1]	Glyceraldehyde-3-phosphate dehydrogenase	24h post-viral infection in GAPDH, heart, liver 72h post-viral infection in heart, liver	DQ848904	F:CAGTGTATGAAGCCAGCAGAG R:GGTCGTATTTGTCCTCATTAACTC	193	60	SYBR
RPL17^[1]	Ribosomal protein L17	24h post-viral infection in brain 72h post-viral infection in brain, gill	DQ848879	F:AACCTGCGAGTTCACTTCAAG R:CCACGCCGCCATTGTAAC	142	60	SYBR
EF1A^[1]	Elongation factor-1-α	24h post-viral infection in brain 72h post-viral infection in brain, gill	AF467776	F:CGTCGGCTTCAACATCAAGAAC R:GTGAGCGGTGTGGCAGTC	181	60	SYBR
RPSD^[1]	RNA polynerase II subunit D	24h post-viral infection in gill, heart, intestine, kidney, spleen 72h post-viral infection in liver, intestine, kidney, spleen	DQ848899	F:AACACAGGAAGCAGCAGAAC R:ACGGCAGTGATGGTCTCTC	124	60	SYBR
ACTB^[1]	β-actin	24h post-viral infection in liver 72h post-viral infection in heart	EU686692	F:CGTGCGTGACATCAAGGAG R:AGGAAGGAAGGCTGGAAGAG	177	60	SYBR
TUBA^[1]	α-tubulin	24h post-viral infection in muscle 72h post-viral infection in muscle	DQ848853	F:CGAGCCAGCCAACCAGATG R:GATGGTGGCGATGGCAGAG	118	60	SYBR
ODC^[1]	Ornithine decarboxylase	24h post-viral infection in spleen 72h post-viral infection in spleen	DQ848853	F:TATGCCGAAGAACATCCTGAAG R:GTCCCGCTCAAAGTTGTAGG	182	60	SYBR

Name: Li Sun
Email: lsun@qdio.ac.cn
Institution: Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China

Cited by 17 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 Zhang J, Hu Y, Sun B, et al. Selection of normalization factors for quantitative real time RT-PCR studies in Japanese flounder (Paralichthys olivaceus) and turbot (Scophthalmus maximus) under conditions of viral infection[J]. Veterinary immunology and immunopathology, 2013, 152(3): 303-316.
↑ Jinxiang Liu, Nayu Zhou, Ruixue Fu, Dandan Cao, Yu Si, Aoyun Li, Haitao Zhao, Quanqi Zhang, Haiyang Yu, The polymorphism of chicken-type lysozyme gene in Japanese flounder (Paralichthys olivaceus) and its association with resistance/susceptibility to Listonella anguillarum. Fish Shellfish Immunol. 2017 May 2;66:43-49. doi: 10.1016/j.fsi.2017.05.010. PMID: 28476668.