Ulva linza

From ICG
Jump to: navigation, search

Description

Ulva linza.png
  • Ulva linza is a green macroalga (seaweed) that is widely used as a model organism in marine biofouling studies, which reproduces by production of spores that rapidly develop into sporelings. It is well known for its distribution in all aquatic habitats including freshwater, brackish environments, marine and fully saline environments throughout the warm temperate and tropical regions of the world. It must cope with dramatic changes because of tidal changes in light intensity, temperature, salinity, and wave action and with the biotic stresses characteristic of dense coastal ecosystems[1][2].
  • Common Name: Green alga
  • NCBI Taxonomy

Different Experimental Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
TUB2[1] Tubulin2
  • Salinity treatments
  • UV treatments
JN543389
  • F:TGGAATCAACTACCAGCCAC
  • R:CGTACATCAGGTCAAACTTGTG
NA 60 SYBR
H2[1] Histone 2
  • Different temperature treatments
  • Desiccation stress treatments
JN543390
  • F:CTACAAGACAGACCTTCGCTTC
  • R:CATCCTTGGGCATAATAGTGAC
NA 60 SYBR
18S[1] 18S rRNA
  • Different light intensity treatments
HM584731
  • F:TGCCTAGTAAGCGCGAGTCA
  • R:AAACGATGGGCAGGGAAAC
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Meitao Dong
  • Email: yenh@ysfri.ac.cn
  • Institution: Qingdao Agricultural University, Qingdao 266109, China

Citation Statistics

Cited by 20 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Dong M, Zhang X, Chi X, et al. The validity of a reference gene is highly dependent on the experimental conditions in green alga Ulva linza[J]. Current genetics, 2012, 58(1): 13-20.
  2. Heydt M, Div車s P, Grunze M, Rosenhahn A. 2009. Analysis of holographic microscopy data to quantitatively investigate three-dimensional settlement dynamics of algal zoospores in the vicinity of surfaces. Eur Phys J E. 30:141-148.

Categories