Valsa mali var. mali

From ICG
Jump to: navigation, search

Description

Valsa mali.png
  • Valsa mali var. mali, is the predominant variety of the causal agent of apple valsa canker in China. The disease cannot be controlled effectively by chemical treatments since the pathogen penetrates extensively into the host phloem and xylem where it is not accessible to conventional fungicide treatments[1][2].
  • Common Name: NA
  • NCBI Taxonomy

Different Strains & Abiotic Stress Treatments

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] 6-phosphogluconate dehydrogenase decarboxylating
  • Universal reference gene
KC248181
  • F:GTGATGGGTGTCAACGAGGA
  • R:ACGGTCTTCTGGGTGGCA
170 60 SYBR
L13[1] 60S ribosomal protein L13
  • Universal reference gene
KC248182
  • F:AGGCCGAGGCTGAGAAGAAGAAAT
  • R:ACCCTAAAGCAGAAGCCAGACCAT
147 60 SYBR
CYP[1] Cyclophilin
  • Universal reference gene
KC248178
  • F:GTGAGAAGTTCGCCGATGAGA
  • R:ACTGGGAGCCGTTGGTGTT
96 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Lili Huang
  • Email: huanglili@nwsuaf.edu.cn
  • Institution: State Key Laboratory of Crop Stress Biology for Arid Areas, Northwest A&F University, Yangling 712100, China

Citation Statistics

Cited by 21 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Yin Z, Ke X, Huang D, et al. Validation of reference genes for gene expression analysis in Valsa mali var. mali using real-time quantitative PCR[J]. World Journal of Microbiology and Biotechnology, 2013, 29(9): 1563-1571.
  2. Wang X, Wei J, Huang L, Kang Z (2011) Re-evaluation of pathogens causing valsa canker on apple in China. Mycologia 103(2):317–324.

Categories