Vernicia fordii

From ICG
Jump to: navigation, search

Description

Vernicia fordii.png
  • Vernicia fordii Hemsl., a species of the genus Vernicia in the spurge (Euphorbiaceae) family, is a kind of subtropical round-crowned deciduous tree. Tung oil extracted from its seeds is considered to be one of the high-value industrial oils, used widely in production of cloth, shoes, waterproofing masonry, clothing, paper and biodiesel. Tung oil is regarded as a conjugated drying oil with a high degree of unsaturation of fatty acids (80% α-eleostearic acid). Following the development and maturation of tung tree seeds, the content of fatty acids gradually increases.
  • Common Name: Tung tree
  • NCBI Taxonomy

Seed Development

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT7[1] Actin7a
  • Seed development
JQ680035
  • F:CGATGAAGCACAGTCCAAA
  • R:AGGTTGAGAGGAGCCTCAGTG
170 82.36 SYBR
EF1a[1] Elongation factor 1-alpha
  • Seed development
JQ680036
  • F:GCCTGGTATGGTTGTGACCT
  • R:GGATCATCCTTGGAGTTGGA
180 84.01 SYBR
UBQ[1] Ubiquitin
  • Seed development
JQ680041
  • F:CCGTGGTGGCTGTTAAGTTT
  • R:AAGGCCATTTCAACATCCTG
193 80.71 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Seed development
JQ680038
  • F:CTGCTAAGGCTGTTGGGAAG
  • R:TCCCTCTGACTCCTCCTTGA
168 83.55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiaojiao Han
  • Email: wyd11111@126.com
  • Institution: State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing, People’s Republic of China

Citation Statistics

Cited by 65 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Han X, Lu M, Chen Y, et al. Selection of reliable reference genes for gene expression studies using real-time PCR in tung tree during seed development[J]. PloS one, 2012, 7(8): e43084.

Categories