Volvox carteri

From ICG
Jump to: navigation, search

Description

Volvox carteri.png
  • The alga Volvox carteri is one of the simplest multicellular organisms which has been seen suitable for studying fundamental and evolutionary issues related to multicellularity, embryonic development, cellular differentiation, morphogenesis, ECM biogenesis and photomovement[1][2] .
  • Common Name: Green alga
  • NCBI Taxonomy

Developmental Stages & Stress Treatments

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18S[1] 18S ribosomal RNA
  • Different developmental stages
  • Cell types
  • Stress treatments
FJ610144
  • F:GATACCGTCGTAGTCTCAACC
  • R:TTCAGCCTTGCGACCATACTC
131 55 SYBR
eef1[1] Eukaryotic translation elongation factor 1a2
  • Different developmental stages
  • Cell types
  • Stress treatments
XP_002948033
  • F:GACGATTGCATGCACCACTAAG
  • R:ATCAGCAGGCACACATCAGC
132 55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Arash Kianianmomeni
  • Email: kianian@uni-bielefeld.de
  • Institution: Department of Cellular and Developmental Biology of Plants, University of Bielefeld, Universitätsstr. 25, 33615 Bielefeld, Germany

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Kianianmomeni A, Hallmann A. Validation of reference genes for quantitative gene expression studies in Volvox carteri using real-time RT-PCR[J]. Molecular biology reports, 2013, 40(12): 6691-6699.
  2. Hallmann A. Extracellular matrix and sex-inducing pheromone in Volvox. Int Rev Cytol. 2003;227:131-82. Review. PubMed PMID: 14518551.

Categories