Zea mays

From ICG
Jump to: navigation, search

Description

Zea mays.png
  • Zea mays subsp. mays is a large grain plant first domesticated by indigenous peoples in southern Mexico about 10,000 years ago. The leafy stalk of the plant produces separate pollen and ovuliferous inflorescences or ears, which are fruits, yielding kernels or seeds. It is one of the most important cereal crops, also plays a growing role in industry and energy resources. However, major global abiotic stresses such as drought, heat, cold, and salinity cause huge reductions in the production every year. Additionally, hormones have been implicated in the plant response to numerous abiotic and biotic stresses, as well as developmental processes[1][2].
  • Common Name: Corn, Maize
  • NCBI Taxonomy

Abiotic Stresses & Hormone Treatment & Tissue Types

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1a[2] Elongation factor 1 alpha
  • Cold, heat, salinity, and PEG
  • Abscisic acid, salicylic acid, jasmonic acid, ethylene, and gibberellins
  • Root, stem and leaf
NM_001112117
  • F:TGGGCCTACTGGTCTTACTACTGA
  • R:ACATACCCACGCTTCAGATCCT
135 61.37~62.13 SYBR
β-TUB[2] Tubulin beta
  • Cold, heat, salinity, and PEG
  • Abscisic acid, salicylic acid, jasmonic acid, ethylene, and gibberellins
  • Root, stem and leaf
NM_001111987
  • F:CTACCTCACGGCATCTGCTATGT
  • R:GTCACACACACTCGACTTCACG
139 61.84~62.74 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Suzhi Zhang
  • Email: suzhi1026@163.com
  • Institution: Key Laboratory of Biology and Genetic Breeding of Maize in Southwest China of Agricultural Department, Maize Research Institute, Sichuan Agricultural University, Chengdu, China

Citation Statistics

Cited by 22 (Based on Google Scholar [2017-09-01])

Landrace Varieties & During Grain Development

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
TUB[3] Beta-5 tubulin
  • Multiple grain developmental stages
NM_001111988
  • F:AGAACTGCGACTGCCTCCAAAGG
  • R:AGATGAGCAGGGTGCCCATTC
84 82.65 SYBR
ACT[3] Actin 1 gene
  • Multiple grain developmental stages
J01238
  • F:CATGGAGAACTGGCATCACACCTT
  • R:CTGCGTCATTTTCTCTCTGTTGGC
118 84.35 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Vanessa Galli
  • Email: vane.galli@yahoo.com.br
  • Institution: Empresa Brasileira de Pesquisa Agropecua ´ria de Clima Temperado, Rodovia BR 396, Km 78 Postal code 403, Pelotas, RS CEP 96001-970, Brazil

Citation Statistics

Cited by 18 (Based on Google Scholar [2017-09-01])

References

  1. Lv JS, Liu XY, Zhang XP, Wang LS (2017) Chemical composition and functional characteristics of dietary fiber-rich powder obtained from core of maize straw. Food chemistry 227, 383-389.
  2. 2.0 2.1 2.2 Lin Y, Zhang C, Lan H, et al. Validation of potential reference genes for qPCR in maize across abiotic stresses, hormone treatments, and tissue types[J]. PLoS One, 2014, 9(5): e95445.
  3. 3.0 3.1 Galli V, da Silva Messias R, e Silva S D A, et al. Selection of reliable reference genes for quantitative real-time polymerase chain reaction studies in maize grains[J]. Plant cell reports, 2013, 32(12): 1869-1877.

Categories