Bos indicus

Description

Bos indicus are the most common type of large domesticated ungulates. They are a prominent modern member of the subfamily Bovinae, are the most widespread species of the genus Bos. They are characterised by a fatty hump on their shoulders, a large dewlap, and sometimes drooping ears. They are well adapted to withstanding high temperatures, and are farmed throughout the tropical countries. They are raised as livestock for meat (beef and veal), as dairy animals for milk and other dairy products. Other products include leather and dung for manure or fuel^[1]^[2].
Common Name: Zebu, Zebu cattle
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
PPP1R11^[1]	Protein phosphatase 1 regulatory subunit 11	Milk somatic cells Multiparous lactating Sahiwal cows Different lactation stages	NM_001100295	F:ACCATCAAACTTCGGAAACG R:CCTCCTCTTCCTCGTCATCA	NA	60	SYBR
ACTB^[1]	β-actin	Milk somatic cells Multiparous lactating Sahiwal cows Different lactation stages	NM_173979	F:CTCTTCCAGCCTTCCTTCCT R:GGGCAGTGATCTCTTTCTGC	NA	63	SYBR
UBC^[1]	Ubiquitin	Milk somatic cells Multiparous lactating Sahiwal cows Different lactation stages	Z18245	F:AGATCCAGGATAAGGAAGGCAT R:GCTCCACCTCCAGGGTGAT	NA	60	SYBR
GAPDH^[1]	Glyceraldehyde-3-phosphate dehydrogenase	Milk somatic cells Multiparous lactating Sahiwal cows Different lactation stages	NM_001034034.1	F:GGGTCATCATCTCTGCACCT R:GGTCATAAGTCCCTCCACGA	NA	62	SYBR

Cited by 15 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 Varshney N, Mohanty A K, Kumar S, et al. Selection of suitable reference genes for quantitative gene expression studies in milk somatic cells of lactating cows (Bos indicus)[J]. Journal of dairy science, 2012, 95(6): 2935-2945.
↑ N. Varshney, A. K. Mohanty , S. Kumar , J. K. Kaushik, A. K. Dang ,M. Mukesh , B. P. Mishra , R. Kataria , S. P. Kimothi ,T. K. Mukhopadhyay , D. Malakar , B. S. Prakash , S. Grover , and V. K. Batish. Selection of suitable reference genes for quantitative gene expression studies in milk somatic cells of lactating cows (Bos indicus). J. Dairy Sci. 95 :2935–2945 http://dx.doi.org/ 10.3168/jds.2011-4442.