Difference between revisions of "Actinidia chinensis"

From ICG
Jump to navigation Jump to search
Line 68: Line 68:
  
 
[[Category:Plants]]
 
[[Category:Plants]]
 +
[[Category:mRNA]] 
 +
[[Category:SYBR]]

Revision as of 07:38, 19 June 2017

Description

REFqPCR2016012-1.jpg
  • Kiwifruit (Actinidia chinensis var. deliciosa (A. Chev.) A. Chev.) is a dioecious species in which size of fruits is strongly dependent on pollination. There are two major factors limiting the efficiency of pollination in this species. These are the short effective pollination period (EPP) of the female cultivar and a lack of flowering coincidence between the female cultivar and the male pollen donor.
  • It is currently accepted that the consumption of kiwifruit has a preventive effect against certain cancers and cardiovascular disease. For example, many different cancers, especially cancers of the digestive system (mainly stomach cancer), lung, and liver, have been treated with kiwifruit prescriptions due to its cytotoxic and antioxidant activities. [1] [2].

Different tissues & organs & developmental stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
18S rRNA[1] Actinidia chinensis 18S ribosomal RNA gene, partial sequence.
  • Sample sets with the exception of the seed
AF419792
  • F:CTGTGAAACTGCGAATGGCTC
  • R:CTGTGAAACTGCGAATGGCTC
110 60 SYBR
ACT[1] Actinidia deliciosa ACT1 (ACT1) mRNA, complete cds.
  • Mature leaves, fruit flesh and stigmatic arms
EF063572
  • F:GCAGGAATCCATGAGACTACC
  • R:GCAGGAATCCATGAGACTACC
120 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: MV González
  • Email: mvictoria.gonzalez@usc.es
  • Institution: Departamento de Fisiología Vegetal, Facultad de Farmacia, Universidad de Santiago, Campus Sur, 15872, Santiago de Compostela, Spain

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 Ferradás Y, Rey L, Martínez Ó, Rey M, González MV (2016) Identification and validation of reference genes for accurate normalization of real-time quantitative PCR data in kiwifruit. Plant Physiology and Biochemistry 102, 27-36.
  2. Du GR, Li MJ, Ma FW, Liang D (2009) Antioxidant capacity and the relationship with polyphenol and Vitamin C in Actinidia fruits. Food Chemistry 113, 557-562.