Acyrthosiphon pisum

From ICG
Revision as of 07:27, 16 June 2017 by ICG Expert4 (talk | contribs) (Created page with "==Description== =='''''Different Developmental Stages & Temperature'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Sym...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Different Developmental Stages & Temperature

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
SDHB[1] succinate dehydrogenase B
  • Universal reference gene
GT035008
  • F:CTGAATTCCTGTGGACCTATGG
  • R:ACGGCAAGAACGCCTAAA
90 55 SYBR
16S[1] 16S ribosomal RNA
  • Universal reference gene
FJ411411
  • F:AGAAACCAACCTGGCTTACAC
  • R:TTGCGACCTCGATGTTGAATTA
121 55 SYBR
NADH[1] NADH dehydrogenase
  • Universal reference gene
NM_001162323
  • F:CGAGGAGAACATGCTCTTAGAC
  • R:GATAGCTTGGGCTGGACATATAG
93 55 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xuguo Zhou
  • Email: xuguozhou@uky.edu
  • Institution: Hunan Academy of Agricultural Sciences, Institute of Plant Protection, Changsha, Hunan, China

References

  1. 1.0 1.1 1.2 Yang C, Pan H, Liu Y, et al. Selection of reference genes for expression analysis using quantitative real-time PCR in the pea aphid, Acyrthosiphon pisum (Harris)(Hemiptera, Aphidiae)[J]. PloS one, 2014, 9(11): e110454.