Acyrthosiphon pisum

Description

Acyrthosiphon pisum is an important cosmopolitan pest. It feeds on a wide range of legume plants worldwide, including pea, clover, alfalfa, and broad bean, and is considered as the aphid species of major agronomical importance. More importantly, it can transmit over 30 plant viruses. In addition, it is an emerging model organism for the studies of insect-plant interactions^[1]^[2].
Common Name: Pea aphid
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
SDHB^[1]	Succinate dehydrogenase B	Different Developmental Stages exposed to 10 ℃, 22 ℃, and 30 ℃ for 2 days	GT035008	F:CTGAATTCCTGTGGACCTATGG R:ACGGCAAGAACGCCTAAA	90	55	SYBR
16S^[1]	16S ribosomal RNA	Different Developmental Stages exposed to 10 ℃, 22 ℃, and 30 ℃ for 2 days	FJ411411	F:AGAAACCAACCTGGCTTACAC R:TTGCGACCTCGATGTTGAATTA	121	55	SYBR
NADH^[1]	NADH dehydrogenase	Different Developmental Stages exposed to 10 ℃, 22 ℃, and 30 ℃ for 2 days	NM_001162323	F:CGAGGAGAACATGCTCTTAGAC R:GATAGCTTGGGCTGGACATATAG	93	55	SYBR

Name: Xuguo Zhou
Email: xuguozhou@uky.edu
Institution: Hunan Academy of Agricultural Sciences, Institute of Plant Protection, Changsha, Hunan, China

Cited by 23 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Yang C, Pan H, Liu Y, et al. Selection of reference genes for expression analysis using quantitative real-time PCR in the pea aphid, Acyrthosiphon pisum (Harris)(Hemiptera, Aphidiae)[J]. PloS one, 2014, 9(11): e110454.
↑ Blackman RL, Eastop VF (2000) Aphids of the World’s Crops – An Identification and Information Guide. John Wiley and Sons, Inc., New York, NY, 466 pp.