Agrostis stolonifera

Description

• Creeping bentgrass (Agrostis stolonifera) is one of the most widely utilized cool-season grass species for turfgrass and forage in temperate climatic regions and displays moderate cold tolerance but is particularly sensitive to other abiotic stresses such as heat, drought, and salinity. Previous studies have focused on creeping bentgrass physiological mechanisms involved in heat, salt, and drought stresses, but limited information is available on the underlying molecular mechanisms conferring improved stress tolerance in creeping bentgrass which deserves further investigation.
• Agrostis stolonifera plants were grown under controlled conditions in environmental chambers for 70, 90, 120 and 160 days. A subset of pots was fertilised with N/P/K after 100 days. Over the 90 days between the first and last harvests microbial biomass declined by 20%. At 70 days respiration was approximately 50% higher in the rhizosphere compared to the bulk soil.
• Agrostis stolonifera is stoloniferous and may form mats or tufts. The prostrate stems of this species grow to 0.4–1.0 metre (1 ft 4 in–3 ft 3 in) long with 2–10-centimetre (0.79–3.94 in) long leaf blades and a panicle reaching up to 40 cm (16 in) in height. .

Abiotic Stresses

Reference Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primer	Size [bp]	Tm [℃]	Detection
CACS	Clathrin adaptor complex subunit	Salinity-treated roots or leaves of creeping bentgrass Roots & leaves of creeping bentgrass under drought stress Cold-treated roots & heat-stressed roots	GR280784	F:TAGAGGGTCTGAAGAGGCG R:TAGAGGGTCTGAAGAGGCG	121	60	SYBR
UPL7	E3 ubiquitin-protein ligase	Salinity-treated roots or leaves of creeping bentgrass Cold-treated leaves of creeping bentgrass Heat-stressed leaves	DV858635	F:AACTTCCTCCAATTCGATCC/ R:AACTTCCTCCAATTCGATCC/	162	60	SYBR
PP2A	Protein phosphatase 2A	Salinity-treated roots or leaves of creeping bentgrass Roots or leaves of creeping bentgrass under drought stress Cold-treated & heat-stressed roots Cold-treated leaves of creeping bentgrass	DV858985	F:AACTTCCTCCAATTCGATCC R:AACTTCCTCCAATTCGATCC	190	60	SYBR
ACT	Actin7	Salinity-treated roots or leaves of creeping bentgrass	DV857524	F:CCTTAGCACCTTCCAACAGA R:CCTTAGCACCTTCCAACAGA	114	60	SYBR
GAPDH	Glyceraldehyde 3-phosphate dehydrogenase	Roots or leaves of creeping bentgrass under drought stress Heat-stressed leaves	GR281777	F:GCCTTCCGTGTTCCTACTGT R:GCCTTCCGTGTTCCTACTGT	191	60	SYBR
PEPKR1	Phosphoenolpyruvate carboxylase- related Kinase 1	Roots or leaves of creeping bentgrass under drought stress.	DV853577	F:ACCGATGTTGTTGGAAGCC R:ACCGATGTTGTTGGAAGCC	116	60	SYBR
EF1a	Elongation factor-1a	Cold-treated leaves of creeping bentgrass	DV858943	F:CAAGGTTACCAAGGCTGCTG R:CAAGGTTACCAAGGCTGCTG	170	60	SYBR

Moleculer Types

• mRNA

Evaluation Methods

• geNorm method && Related Reference
• NormFinder method && Related Reference
• BestKeeper method && Related Reference
• Ref-Finder method && Related Reference

Contact

• Name: Zhimin Yang
• Email: nauyzm@njau.edu.cn
• Institution: College of Agro-grassland Science, Nanjing Agricultural University, Nanjing 210095, China

Citation Statistics

Cited by 149 (Based on Google Scholar [2017-06-01])