Agrostis stolonifera

From ICG
Revision as of 10:16, 16 June 2017 by ICG Expert4 (talk | contribs)
Jump to navigation Jump to search

Description

REFqPCR2015011-1.jpg
  • Creeping bentgrass (Agrostis stolonifera) is one of the most widely utilized cool-season grass species for turfgrass and forage in temperate climatic regions and displays moderate cold tolerance but is particularly sensitive to other abiotic stresses such as heat, drought, and salinity. Previous studies have focused on creeping bentgrass physiological mechanisms involved in heat, salt, and drought stresses, but limited information is available on the underlying molecular mechanisms conferring improved stress tolerance in creeping bentgrass which deserves further investigation.
  • Agrostis stolonifera plants were grown under controlled conditions in environmental chambers for 70, 90, 120 and 160 days. A subset of pots was fertilised with N/P/K after 100 days. Over the 90 days between the first and last harvests microbial biomass declined by 20%. At 70 days respiration was approximately 50% higher in the rhizosphere compared to the bulk soil.
  • Agrostis stolonifera is stoloniferous and may form mats or tufts. The prostrate stems of this species grow to 0.4–1.0 metre (1 ft 4 in–3 ft 3 in) long with 2–10-centimetre (0.79–3.94 in) long leaf blades and a panicle reaching up to 40 cm (16 in) in height. [1] [2].

Abiotic Stresses

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
CACS[1] Clathrin adaptor complex subunit
  • Salinity-treated roots or leaves of creeping bentgrass
  • Roots & leaves of creeping bentgrass under drought stress
  • Cold-treated roots & Heat-stressed roots
GR280784
  • F:TAGAGGGTCTGAAGAGGCG
  • R:TAGAGGGTCTGAAGAGGCG
121 60 SYBR
UPL7[1] E3 ubiquitin-protein ligase
  • Salinity-treated roots or leaves of creeping bentgrass
  • Cold-treated leaves of creeping bentgrass
  • Heat-stressed leaves
DV858635
  • F:AACTTCCTCCAATTCGATCC/
  • R:AACTTCCTCCAATTCGATCC/
162 60 SYBR
PP2A[1] Protein phosphatase 2A
  • Salinity-treated roots or leaves of creeping bentgrass
  • Roots or leaves of creeping bentgrass under drought stress
  • Cold-treated & heat-stressed roots
  • Cold-treated leaves of creeping bentgrass
DV858985
  • F:AACTTCCTCCAATTCGATCC
  • R:AACTTCCTCCAATTCGATCC
190 60 SYBR
ACT[1] Actin7
  • Salinity-treated roots or leaves of creeping bentgrass
DV857524
  • F:CCTTAGCACCTTCCAACAGA
  • R:CCTTAGCACCTTCCAACAGA
114 60 SYBR
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Roots or leaves of creeping bentgrass under drought stress
  • Heat-stressed leaves
GR281777
  • F:GCCTTCCGTGTTCCTACTGT
  • R:GCCTTCCGTGTTCCTACTGT
191 60 SYBR
PEPKR1[1] Phosphoenolpyruvate carboxylase- related Kinase 1
  • Roots or leaves of creeping bentgrass under drought stress.
DV853577
  • F:ACCGATGTTGTTGGAAGCC
  • R:ACCGATGTTGTTGGAAGCC
116 60 SYBR
EF1a[1] Elongation factor-1a
  • Cold-treated leaves of creeping bentgrass
DV858943
  • F:CAAGGTTACCAAGGCTGCTG
  • R:CAAGGTTACCAAGGCTGCTG
170 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhimin Yang
  • Email: nauyzm@njau.edu.cn
  • Institution: College of Agro-grassland Science, Nanjing Agricultural University, Nanjing 210095, China

Citation Statistics

Cited by 149 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Steer J, Harris JA (2000) Shifts in the microbial community in rhizosphere and non-rhizosphere soils during the growth of Agrostis stolonifera. Soil Biology & Biochemistry 32, 869-878.
  2. Chen Y, Hu B, Tan Z, et al. (2015) Selection of reference genes for quantitative real-time PCR normalization in creeping bentgrass involved in four abiotic stresses. Plant Cell Rep 34, 1825-1834.