Agrostis stolonifera

Description

• Agrostis stolonifera is one of the most widely utilized cool-season grass species for turfgrass and forage in temperate climatic regions and displays moderate cold tolerance but is particularly sensitive to other abiotic stresses such as heat, drought, and salinity. Most studies focused on creeping bentgrass physiological mechanisms involved in heat, salt, and drought stresses, but limited information is available on the underlying molecular mechanisms conferring improved stress tolerance .
• Common Name: Creeping bentgrass, Creeping bent, Fiorin, Spreading bent
• NCBI Taxonomy

Abiotic Stresses

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
CACS	Clathrin adaptor complex subunit	Salinity-treated roots or leaves of creeping bentgrass Roots & leaves of creeping bentgrass under drought stress Cold-treated roots & heat-stressed roots	GR280784	F:TAGAGGGTCTGAAGAGGCG R:CTGGTGTGATCGAAAAGTGG	121	60	SYBR
UPL7	E3 ubiquitin-protein ligase	Salinity-treated roots or leaves of creeping bentgrass Cold-treated leaves of creeping bentgrass Heat-stressed leaves	DV858635	F:TGTGACTGGATGTTTTCGTGG R:TTGGTTTTGTATGGGGGGA	162	60	SYBR
PP2A	Protein phosphatase 2A	Salinity-treated roots or leaves of creeping bentgrass Roots or leaves of creeping bentgrass under drought stress Cold-treated & heat-stressed roots Cold-treated leaves of creeping bentgrass	DV858985	F:AACTTCCTCCAATTCGATCC R:AACTTCCTCCAATTCGATCC	190	60	SYBR
ACT	Actin7	Salinity-treated roots or leaves of creeping bentgrass	DV857524	F:CCTTAGCACCTTCCAACAGA R:AAGTGGAAAGACCCAAGACAA	114	60	SYBR
GAPDH	Glyceraldehyde 3-phosphate dehydrogenase	Roots or leaves of creeping bentgrass under drought stress Heat-stressed leaves	GR281777	F:GCCTTCCGTGTTCCTACTGT R:AAGATGCTGGACCTGCTGTC	191	60	SYBR
PEPKR1	Phosphoenolpyruvate carboxylase- related Kinase 1	Roots or leaves of creeping bentgrass under drought stress.	DV853577	F:ACCGATGTTGTTGGAAGCC R:ACACCACTCAGCAGAATGTAGAG	116	60	SYBR
EF1a	Elongation factor-1a	Cold-treated leaves of creeping bentgrass	DV858943	F:CAAGGTTACCAAGGCTGCTG R:GGTTTTGCCGAACATGAAATAG	170	60	SYBR

Molecular Types

• mRNA

Evaluation Methods

• geNorm method && Related Reference
• NormFinder method && Related Reference
• BestKeeper method && Related Reference
• Ref-Finder method && Related Reference

Contact

• Name: Zhimin Yang
• Email: nauyzm@njau.edu.cn
• Institution: College of Agro-grassland Science, Nanjing Agricultural University, Nanjing 210095, China

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-09-01])