Difference between revisions of "Ammopiptanthus mongolicus"

From ICG
Jump to navigation Jump to search
 
(19 intermediate revisions by 8 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
+
[[File:Ammopiptanthus mongolicus.png|right|200px|link=Ammopiptanthus mongolicus]]
[[File:Ammopiptanthus mongolicus-1.png|right|327px|]]
+
* '''''Ammopiptanthus mongolicus''''', the only evergreen broadleaf shrub endemic to the northwest desert of China, is the only genus of evergreen broadleaf shrub in the northwest desert of China and is dominant in the local vegetation. It plays important roles in fixing moving sands and delaying further desertification. It is a valuable species for plant abiotic stress research and has been proposed as a valuable species for research on plant abiotic stress tolerance<ref name="ref1"/><ref name="ref2"/>.
* Ammopiptanthus mongolicus, the only evergreen broadleaf shrub endemic to the northwest desert of China, It is the only genus of evergreen broadleaf shrub in the northwest desert of China and both species are dominant in the local vegetation, so this genus plays an important role in fixing moving sands and delaying further desertification.is a valuable species for plant abiotic stress research.It has been proposed as a valuable species for research on plant abiotic stress tolerance<ref name="ref1"/> <ref name="ref2"/>.  
+
* <font color=blue>'''Common Name:'''</font> '''Leguminosae'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=126911 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Abiotic Stresses'''''==
 
=='''''Abiotic Stresses'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 17: Line 18:
 
! Detection
 
! Detection
 
|-
 
|-
|align="center"| 18S<ref name="ref1"/>
+
|align="center"| eIF1<ref name="ref1"/>
|align="center"| Ribosomal RNA 18S
+
|align="center"| Eukaryotic initiation factor
 
|
 
|
* Various abiotic stresses
+
* Cold stresses
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/HM582444 '''AY491942.1 ''']  
+
* Dry stresses
 +
* Salt stresses
 +
* Heat stresses
 +
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JN885965 '''JN885965''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:AACGAGACCTCAGCCTGCTA
+
* F:CTGACATGCGCCGTAGGAACG
* R:AAGATTACCCAAGCCTGTCG
+
* R:CCCTGCTTATGCCAGTCTTTT
|align="center"| 200
+
|align="center"| 153
 
|align="center"| 60
 
|align="center"| 60
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
|align="center"| EF1A<ref name="ref1"/>
+
|align="center"| eIF3<ref name="ref1"/>
|align="center"| Elongation factor 1-alpha
+
|align="center"| Eukaryotic initiation factor
 
|
 
|
* Various abiotic stresses
+
* Cold stresses
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GO346663 '''GO346663 ''']  
+
* Dry stresses
 +
* Salt stresses
 +
* Heat stresses
 +
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JN885967 '''JN885967''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:GAGAAGGAAGCTGCTGAAATG
+
* F:TTACATCGTCATCAAGGGTCG
* R:GAACAGCACAATCAGCCTGAG
+
* R:ACAATTATGGGAAGACGGCAC
|align="center"| 214
+
|align="center"| 153
|align="center"| 60
 
|align="center"| SYBR
 
|-
 
|align="center"| NTUBC<ref name="ref1"/>
 
|align="center"| Ubiquitin-conjugating enzyme
 
|
 
* Various abiotic stresses
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GO347619 '''GO347619''']
 
|nowrap style="font-size:9pt"|
 
* F:TCTGCTCGATTCCGAGTTTT
 
* R:GCTTGAAGTCCCTCATCAGC
 
|align="center"| 128
 
|align="center"| 60
 
|align="center"| SYBR
 
|-
 
|align="center"| UBI<ref name="ref1"/>
 
|align="center"| Ubiquitin
 
|
 
* Various abiotic stresses
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GO347694 '''GO347694''']
 
|nowrap style="font-size:9pt"|
 
* F:CACCCTCGCTGACTACAACA
 
* R:TTTCTCAGCCTGACGACCTT
 
|align="center"| 195
 
 
|align="center"| 60
 
|align="center"| 60
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
  
===Molecular types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 75: Line 58:
 
*'''Name''': Jing Shi
 
*'''Name''': Jing Shi
 
*'''Email''': yinwl@bjfu.edu.cn
 
*'''Email''': yinwl@bjfu.edu.cn
*'''Institute''': National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, College of Biological Sciences and Biotechnology, Beijing Forestry University Beijing 100083, China
+
*'''Institution''': National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, College of Biological Sciences and Biotechnology, Beijing Forestry University Beijing 100083, China
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''19''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=9133494439483364061&as_sdt=2005&sciodt=0,5&hl=en '''19'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 89: Line 72:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Plants]]
 
[[Category:Plants]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
  
 
[[Category:SYBR]]
 
[[Category:SYBR]]
[[Category:18S rRNA]] [[Category:EF1α]] [[Category:Ubiquitin]] [[Category:Ubiquitin]]
+
[[Category:eIF]]
 
[[Category:Abiotic Stress]]
 
[[Category:Abiotic Stress]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 07:25, 1 September 2017

Description

Ammopiptanthus mongolicus.png
  • Ammopiptanthus mongolicus, the only evergreen broadleaf shrub endemic to the northwest desert of China, is the only genus of evergreen broadleaf shrub in the northwest desert of China and is dominant in the local vegetation. It plays important roles in fixing moving sands and delaying further desertification. It is a valuable species for plant abiotic stress research and has been proposed as a valuable species for research on plant abiotic stress tolerance[1][2].
  • Common Name: Leguminosae
  • NCBI Taxonomy

Abiotic Stresses

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
eIF1[1] Eukaryotic initiation factor
  • Cold stresses
  • Dry stresses
  • Salt stresses
  • Heat stresses
JN885965
  • F:CTGACATGCGCCGTAGGAACG
  • R:CCCTGCTTATGCCAGTCTTTT
153 60 SYBR
eIF3[1] Eukaryotic initiation factor
  • Cold stresses
  • Dry stresses
  • Salt stresses
  • Heat stresses
JN885967
  • F:TTACATCGTCATCAAGGGTCG
  • R:ACAATTATGGGAAGACGGCAC
153 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jing Shi
  • Email: yinwl@bjfu.edu.cn
  • Institution: National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, College of Biological Sciences and Biotechnology, Beijing Forestry University Beijing 100083, China

Citation Statistics

Cited by 19 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Shi J, Liu M, Shi J, et al. Reference gene selection for qPCR in Ammopiptanthus mongolicus under abiotic stresses and expression analysis of seven ROS-scavenging enzyme genes[J]. Plant cell reports, 2012, 31(7): 1245-1254.
  2. Libauh M, Thibivilliers S, Bilgin DD, Radwan O, Benitez M, Clough SJ, Stacey G (2008) Identification of four soybean reference genes for gene expression normalization. Plant Genome 1:44–54.

Categories