Difference between revisions of "Anastrepha obliqua"

From ICG
Jump to navigation Jump to search
 
(23 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2016015-1.jpg|right|327px|]]
+
[[File:Anastrepha obliqua.png|right|200px|link=Anastrepha obliqua]]
* The West Indian fruit fly, Anastrepha obliqua, is an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control.
+
* '''''Anastrepha obliqua''''', a kind of tephritid fruit flies, which is also an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control. The genus Anastrepha has over 235 species, most of them are endemic to the Neotropics. Only a few of these species, mostly in the fraterculus group, are agricultural pests, including ''Anastrepha obliqua''. Because of the vast damage they inflict to several different fruit crops, they are of great economic importance, which elicit the development of several pest management strategies<ref name="ref1"/> <ref name="ref2"/>.
* The genus Anastrepha has over 235 species 1 most of them endemic to the Neotropics. Only a few of these species, mostly in the fraterculus group, are agricultural pests, including the West Indies fruit fly Anastrepha obliqua (Diptera, Tephritidae). Because of the vast damage they inflict to several different fruit crops, they are of great economic importance, which elicit the development of several pest management strategies.
+
* <font color=blue>'''Common Name:'''</font> '''West Indian fruit fly'''
* The genus Anastrepha of tephritid fruit flies comprises over 250 described species, arranged in 17 infrageneric taxonomic groups. To date, only general aspects of the external eggshell morphology of 38 species have been studied, with emphasis on egg-size and shape, the presence of respiratory lobes and the possible existence of chorion sculpturing. <ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=95512 <font color=blue>'''NCBI Taxonomy'''</font>]
  
=='''''Developmental Stages'''''==
+
=='''''Different Developmental Stages'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 19: Line 19:
 
|-
 
|-
 
|align="center"| rpL18<ref name="ref1"/>
 
|align="center"| rpL18<ref name="ref1"/>
|align="center"| ribosomal protein L18, transcript variant 
+
|align="center"| Ribosomal protein L18
 
|
 
|
* Developmental stages
+
* 2nd and 3rd larval instars (LII and LIII);
 +
* Early pupal stage (PI);
 +
* Later pupal stage (PII);
 +
* Sexually mature virgin males and females (MVF);
 +
* Post-mating males (PMM) and females (PMF);
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_139834 '''NM_139834''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_139834 '''NM_139834''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GTGCCTAAGATGACCATTTGC
 
* F:GTGCCTAAGATGACCATTTGC
* R:GTGCCTAAGATGACCATTTGC
+
* R:GACCTCCAGCCTTAATGATACG
 
|align="center"|  NA  
 
|align="center"|  NA  
 
|align="center"| 58
 
|align="center"| 58
Line 31: Line 35:
 
|-
 
|-
 
|align="center"| rps17<ref name="ref1"/>
 
|align="center"| rps17<ref name="ref1"/>
|align="center"| ribosomal protein S17 (RpS17), mRNA 
+
|align="center"| Ribosomal protein S17
 
|
 
|
* Developmental stages
+
* 2nd and 3rd larval instars (LII and LIII);
 +
* Early pupal stage (PI);
 +
* Later pupal stage (PII);
 +
* Sexually mature virgin males and females (MVF);
 +
* Post-mating males (PMM) and females (PMF);
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_079278.2 '''NM_079278.2''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_079278.2 '''NM_079278.2''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GCCGCAAAGGTCATAATTGAG
 
* F:GCCGCAAAGGTCATAATTGAG
* R:GCCGCAAAGGTCATAATTGAG
+
* R:GCTACTTCTTCACAAATACGCT
 
|align="center"|  NA  
 
|align="center"|  NA  
 
|align="center"| 58
 
|align="center"| 58
Line 43: Line 51:
 
|-
 
|-
 
|align="center"| ef1a<ref name="ref1"/>
 
|align="center"| ef1a<ref name="ref1"/>
|align="center"| elongation factor-1 alpha (EF1a) mRNA 
+
|align="center"| Elongation factor-1 alpha
 
|
 
|
* Developmental stages
+
* 2nd and 3rd larval instars (LII and LIII);
 +
* Early pupal stage (PI);
 +
* Later pupal stage (PII);
 +
* Sexually mature virgin males and females (MVF);
 +
* Post-mating males (PMM) and females (PMF);
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/GU339154.1 '''GU339154.1''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/GU339154.1 '''GU339154.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TTGCCTTCGTACCAATCTCTG
 
* F:TTGCCTTCGTACCAATCTCTG
* R:TTGCCTTCGTACCAATCTCTG
+
* R:AACCTTCCATCCCTTGAACC
 
|align="center"|  NA  
 
|align="center"|  NA  
 
|align="center"| 59
 
|align="center"| 59
 
|align="center"| SsoFast
 
|align="center"| SsoFast
 
|}
 
|}
===Moleculer Types===
+
 
 +
===Molecular Types===
 
*mRNA
 
*mRNA
 
===Evaluation Methods===  
 
===Evaluation Methods===  
Line 64: Line 77:
 
*'''Email''': brito@ufscar.br
 
*'''Email''': brito@ufscar.br
 
*'''Institution''':Departamento de Genética e Evolução, Universidade Federal de São Carlos, São Carlos, Brazil.
 
*'''Institution''':Departamento de Genética e Evolução, Universidade Federal de São Carlos, São Carlos, Brazil.
==Citation Statistics==
+
 
Cited by '''10''' (Based on Google Scholar [2017-06-01])
+
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=10853602284664718389&as_sdt=2005&sciodt=0,5&hl=en '''9'''] (Based on Google Scholar [2017-09-01])
 +
 
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
Figueiredo JV, Perondini AL, Selivon D (2017) Patterns of inner chorion structure in Anastrepha (Diptera: Tephritidae) eggs. Arthropod Struct Dev 46, 236-245.
+
Nakamura AM, Chahad-Ehlers S, Lima AL, et al. (2016) Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua. Sci Rep 6, 17480.
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
Nakamura AM, Chahad-Ehlers S, Lima AL, et al. (2016) Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua. Sci Rep 6, 17480.
+
Figueiredo JV, Perondini AL, Selivon D (2017) Patterns of inner chorion structure in Anastrepha (Diptera: Tephritidae) eggs. Arthropod Struct Dev 46, 236-245.
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
[[Category:mRNA]] 
+
[[Category:mRNA]]
 
[[Category:SsoFast]]
 
[[Category:SsoFast]]
 
[[Category:EF1α]] [[Category:RPL]] [[Category:RPS]]
 
[[Category:EF1α]] [[Category:RPL]] [[Category:RPS]]
 +
[[Category:Different Developmental Stages]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:RefFinder]]

Latest revision as of 01:19, 8 September 2017

Description

Anastrepha obliqua.png
  • Anastrepha obliqua, a kind of tephritid fruit flies, which is also an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control. The genus Anastrepha has over 235 species, most of them are endemic to the Neotropics. Only a few of these species, mostly in the fraterculus group, are agricultural pests, including Anastrepha obliqua. Because of the vast damage they inflict to several different fruit crops, they are of great economic importance, which elicit the development of several pest management strategies[1] [2].
  • Common Name: West Indian fruit fly
  • NCBI Taxonomy

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
rpL18[1] Ribosomal protein L18
  • 2nd and 3rd larval instars (LII and LIII);
  • Early pupal stage (PI);
  • Later pupal stage (PII);
  • Sexually mature virgin males and females (MVF);
  • Post-mating males (PMM) and females (PMF);
NM_139834
  • F:GTGCCTAAGATGACCATTTGC
  • R:GACCTCCAGCCTTAATGATACG
NA 58 SsoFast
rps17[1] Ribosomal protein S17
  • 2nd and 3rd larval instars (LII and LIII);
  • Early pupal stage (PI);
  • Later pupal stage (PII);
  • Sexually mature virgin males and females (MVF);
  • Post-mating males (PMM) and females (PMF);
NM_079278.2
  • F:GCCGCAAAGGTCATAATTGAG
  • R:GCTACTTCTTCACAAATACGCT
NA 58 SsoFast
ef1a[1] Elongation factor-1 alpha
  • 2nd and 3rd larval instars (LII and LIII);
  • Early pupal stage (PI);
  • Later pupal stage (PII);
  • Sexually mature virgin males and females (MVF);
  • Post-mating males (PMM) and females (PMF);
GU339154.1
  • F:TTGCCTTCGTACCAATCTCTG
  • R:AACCTTCCATCCCTTGAACC
NA 59 SsoFast

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Reinaldo Alves de Brito
  • Email: brito@ufscar.br
  • Institution:Departamento de Genética e Evolução, Universidade Federal de São Carlos, São Carlos, Brazil.

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Nakamura AM, Chahad-Ehlers S, Lima AL, et al. (2016) Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua. Sci Rep 6, 17480.
  2. Figueiredo JV, Perondini AL, Selivon D (2017) Patterns of inner chorion structure in Anastrepha (Diptera: Tephritidae) eggs. Arthropod Struct Dev 46, 236-245.

Categories