Difference between revisions of "Anastrepha obliqua"

From ICG
Jump to navigation Jump to search
(Created page with "==Description== right|327px| * The West Indian fruit fly, Anastrepha obliqua, is an important agricultural pest in the New World. The use of pest...")
 
Line 64: Line 64:
 
*'''Email''': brito@ufscar.br
 
*'''Email''': brito@ufscar.br
 
*'''Institution''':Departamento de Genética e Evolução, Universidade Federal de São Carlos, São Carlos, Brazil.
 
*'''Institution''':Departamento de Genética e Evolução, Universidade Federal de São Carlos, São Carlos, Brazil.
 +
==Citation Statistics==
 +
Cited by '''10''' (Based on Google Scholar [2017-06-01])
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
Line 73: Line 75:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
[[Category:Animals]]

Revision as of 09:56, 16 June 2017

Description

REFqPCR2016015-1.jpg
  • The West Indian fruit fly, Anastrepha obliqua, is an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control.
  • The genus Anastrepha has over 235 species 1 most of them endemic to the Neotropics. Only a few of these species, mostly in the fraterculus group, are agricultural pests, including the West Indies fruit fly Anastrepha obliqua (Diptera, Tephritidae). Because of the vast damage they inflict to several different fruit crops, they are of great economic importance, which elicit the development of several pest management strategies.
  • The genus Anastrepha of tephritid fruit flies comprises over 250 described species, arranged in 17 infrageneric taxonomic groups. To date, only general aspects of the external eggshell morphology of 38 species have been studied, with emphasis on egg-size and shape, the presence of respiratory lobes and the possible existence of chorion sculpturing. [1] [2].

Developmental Stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
rpL18[1] ribosomal protein L18, transcript variant
  • Developmental stages
NM_139834
  • F:GTGCCTAAGATGACCATTTGC
  • R:GTGCCTAAGATGACCATTTGC
NA 58 SsoFast
rps17[1] ribosomal protein S17 (RpS17), mRNA
  • Developmental stages
NM_079278.2
  • F:GCCGCAAAGGTCATAATTGAG
  • R:GCCGCAAAGGTCATAATTGAG
NA 58 SsoFast
ef1a[1] elongation factor-1 alpha (EF1a) mRNA
  • Developmental stages
GU339154.1
  • F:TTGCCTTCGTACCAATCTCTG
  • R:TTGCCTTCGTACCAATCTCTG
NA 59 SsoFast

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Reinaldo Alves de Brito
  • Email: brito@ufscar.br
  • Institution:Departamento de Genética e Evolução, Universidade Federal de São Carlos, São Carlos, Brazil.

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 Figueiredo JV, Perondini AL, Selivon D (2017) Patterns of inner chorion structure in Anastrepha (Diptera: Tephritidae) eggs. Arthropod Struct Dev 46, 236-245.
  2. Nakamura AM, Chahad-Ehlers S, Lima AL, et al. (2016) Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua. Sci Rep 6, 17480.