Difference between revisions of "Anguilla anguilla"

From ICG
Jump to navigation Jump to search
 
(6 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:Anguilla anguilla.png|right|200px|]]
+
[[File:Anguilla anguilla.png|right|200px|link=Anguilla anguilla]]
 
*'''''Anguilla anguilla''''' is a catadromous teleost, which exhibits a complex life cycle with spawning in the ocean and growing up in continental waters. Eel landings have decreased rapidly throughout Europe since the 1960s, its landings have declined by over 90% compared to the beginning of the 2000s. However, eel landings in freshwaters have remained steady<ref name="ref1"/><ref name="ref2"/>.  
 
*'''''Anguilla anguilla''''' is a catadromous teleost, which exhibits a complex life cycle with spawning in the ocean and growing up in continental waters. Eel landings have decreased rapidly throughout Europe since the 1960s, its landings have declined by over 90% compared to the beginning of the 2000s. However, eel landings in freshwaters have remained steady<ref name="ref1"/><ref name="ref2"/>.  
 
* <font color=blue>'''Common Name:'''</font> '''European eel'''
 
* <font color=blue>'''Common Name:'''</font> '''European eel'''
Line 6: Line 6:
  
 
=='''''Silvering'''''==
 
=='''''Silvering'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 21: Line 21:
 
|align="center"| Ribosomal protein L13
 
|align="center"| Ribosomal protein L13
 
|
 
|
* Universal reference gene
+
* Female eels showing different silver indexes
 
+
* Different seasons
 +
* Hepatocytes
 
|align="center"| [http://compgen.bio.unipd.it/eeelbase/contig/eeel2_c1081 '''eeel2_c1081''']
 
|align="center"| [http://compgen.bio.unipd.it/eeelbase/contig/eeel2_c1081 '''eeel2_c1081''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 34: Line 35:
 
|align="center"| Acidic ribosomal protein
 
|align="center"| Acidic ribosomal protein
 
|
 
|
* Universal reference gene
+
* Female eels showing different silver indexes
 
+
* Different seasons
 +
* Hepatocytes
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY763793 '''AY763793''']
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY763793 '''AY763793''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 60: Line 62:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''3''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=13175235625122688467&as_sdt=2005&sciodt=0,5&hl=en '''4'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 71: Line 73:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Animals]] [[Category:mRNA]] [[Category:SYBR]]
 
[[Category:Animals]] [[Category:mRNA]] [[Category:SYBR]]
 
[[Category:ARP]] [[Category:RPL]][[Category:Silvering]]  [[Category:Different Developmental Stages]]
 
[[Category:ARP]] [[Category:RPL]][[Category:Silvering]]  [[Category:Different Developmental Stages]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]
 +
[[Category:RefFinder]]

Latest revision as of 06:09, 1 September 2017

Description

Anguilla anguilla.png
  • Anguilla anguilla is a catadromous teleost, which exhibits a complex life cycle with spawning in the ocean and growing up in continental waters. Eel landings have decreased rapidly throughout Europe since the 1960s, its landings have declined by over 90% compared to the beginning of the 2000s. However, eel landings in freshwaters have remained steady[1][2].
  • Common Name: European eel
  • NCBI Taxonomy

Silvering

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
L13[1] Ribosomal protein L13
  • Female eels showing different silver indexes
  • Different seasons
  • Hepatocytes
eeel2_c1081
  • F:AAAGGAAGCGTATGGTGGTG
  • R:CGGTCTTCTTCTTGCCGTAG
180 60 SYBR
ARP[1] Acidic ribosomal protein
  • Female eels showing different silver indexes
  • Different seasons
  • Hepatocytes
AY763793
  • F:GTGCCAGCTCAGAACACTG
  • R:ACATCGCTCAAGACTTCAATGG
107 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Elena Fabbri
  • Email: silvia.franzellitti@unibo.it
  • Institution: University of Bologna, Department of Biological, Geological, and Environmental Sciences, via Selmi 3, 40100 Bologna Italy

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Franzellitti S, Kiwan A, Valbonesi P, Fabbri E (2015) Selection of best-performing reference gene products for investigating transcriptional regulation across silvering in the European eel (Anguilla anguilla). Sci Rep 5, 16966.
  2. Silm M, Bernotas P, Haldna M, Jarvalt A, Noges T (2017) Age and growth of European eel, Anguilla Anguilla (Linnaeus, 1758), in Estonian lakes. Journal of Applied Ichthyology 33, 236-241.

Categories