Difference between revisions of "Anguilla anguilla"

From ICG
Jump to navigation Jump to search
 
(19 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
−
[[File:REFqPCR2015034-1.jpg|right|327px|]]
+
[[File:Anguilla anguilla.png|right|200px|link=Anguilla anguilla]]
−
* The European eel (Anguilla anguilla) is a catadromous teleost, which exhibits a complex life cycle with spawning in the ocean and growing up in continental waters. After spawning in the Sargasso Sea, within the North Atlantic gyre, eel larvae follow the Atlantic currents towards continental waters of Europe and North Africa, where they metamorphose into glass eels.
+
*'''''Anguilla anguilla''''' is a catadromous teleost, which exhibits a complex life cycle with spawning in the ocean and growing up in continental waters. Eel landings have decreased rapidly throughout Europe since the 1960s, its landings have declined by over 90% compared to the beginning of the 2000s. However, eel landings in freshwaters have remained steady<ref name="ref1"/><ref name="ref2"/>.  
−
* After reaching coastal waters, estuaries, lagoons, rivers and lakes, they turn into yellow (sexually immature) eels and remain for several years in continental waters until they undergo a pre-pubertal secondary metamorphosis called silvering and transform into silver eels. The silver eels migrate back to spawning grounds, where they eventually mate and die.
+
* <font color=blue>'''Common Name:'''</font> '''European eel'''
−
* Eel landings have decreased rapidly throughout Europe since the 1960s (ICES, 2014). The same applies for the coastal waters of Estonia, where eel landings have declined by over 90% compared to the beginning of the 2000s. However, eel landings in freshwaters have remained steady for the past 5 years (averaging 15 tonnes/year; ICES, 2015), as these populations rely completely on stocking.<ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=7936 <font color=blue>'''NCBI Taxonomy'''</font>]
  
−
=='''''During Silvering'''''==
+
=='''''Silvering'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 13:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 19: Line 19:
 
|-
 
|-
 
|align="center"| L13<ref name="ref1"/>
 
|align="center"| L13<ref name="ref1"/>
−
|align="center"| ribosomal protein L13
+
|align="center"| Ribosomal protein L13
 
|
 
|
−
* Universal reference gene
+
* Female eels showing different silver indexes
−
 
+
* Different seasons
 +
* Hepatocytes
 
|align="center"| [http://compgen.bio.unipd.it/eeelbase/contig/eeel2_c1081 '''eeel2_c1081''']
 
|align="center"| [http://compgen.bio.unipd.it/eeelbase/contig/eeel2_c1081 '''eeel2_c1081''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:AAAGGAAGCGTATGGTGGTG
 
* F:AAAGGAAGCGTATGGTGGTG
−
* R:AAAGGAAGCGTATGGTGGTG
+
* R:CGGTCTTCTTCTTGCCGTAG
 
|align="center"|  180  
 
|align="center"|  180  
 
|align="center"| 60
 
|align="center"| 60
Line 34: Line 35:
 
|align="center"| Acidic ribosomal protein
 
|align="center"| Acidic ribosomal protein
 
|
 
|
−
* Universal reference gene
+
* Female eels showing different silver indexes
−
 
+
* Different seasons
 +
* Hepatocytes
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY763793 '''AY763793''']
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY763793 '''AY763793''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GTGCCAGCTCAGAACACTG
 
* F:GTGCCAGCTCAGAACACTG
−
* R:GTGCCAGCTCAGAACACTG
+
* R:ACATCGCTCAAGACTTCAATGG
 
|align="center"|  107  
 
|align="center"|  107  
 
|align="center"| 60
 
|align="center"| 60
Line 45: Line 47:
 
|}
 
|}
  
−
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 58: Line 61:
 
*'''Institution''': University of Bologna, Department of Biological, Geological, and Environmental Sciences, via Selmi 3, 40100 Bologna Italy
 
*'''Institution''': University of Bologna, Department of Biological, Geological, and Environmental Sciences, via Selmi 3, 40100 Bologna Italy
  
−
==Citation Statistics==
+
===Citation Statistics===
−
Cited by '''3''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=13175235625122688467&as_sdt=2005&sciodt=0,5&hl=en '''4'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
−
Silm M, Bernotas P, Haldna M, Jarvalt A, Noges T (2017) Age and growth of European eel, Anguilla Anguilla (Linnaeus, 1758), in Estonian lakes. Journal of Applied Ichthyology 33, 236-241.
+
Franzellitti S, Kiwan A, Valbonesi P, Fabbri E (2015) Selection of best-performing reference gene products for investigating transcriptional regulation across silvering in the European eel (Anguilla anguilla). Sci Rep 5, 16966.
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
−
Franzellitti S, Kiwan A, Valbonesi P, Fabbri E (2015) Selection of best-performing reference gene products for investigating transcriptional regulation across silvering in the European eel (Anguilla anguilla). Sci Rep 5, 16966.
+
Silm M, Bernotas P, Haldna M, Jarvalt A, Noges T (2017) Age and growth of European eel, Anguilla Anguilla (Linnaeus, 1758), in Estonian lakes. Journal of Applied Ichthyology 33, 236-241.
 
</ref>
 
</ref>
 
</references>
 
</references>
−
[[Category:Animals]]
+
=='''Categories'''==
 +
[[Category:Animals]] [[Category:mRNA]] [[Category:SYBR]]
 +
[[Category:ARP]] [[Category:RPL]][[Category:Silvering]]  [[Category:Different Developmental Stages]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]
 +
[[Category:RefFinder]]

Latest revision as of 06:09, 1 September 2017

Description

Anguilla anguilla.png
  • Anguilla anguilla is a catadromous teleost, which exhibits a complex life cycle with spawning in the ocean and growing up in continental waters. Eel landings have decreased rapidly throughout Europe since the 1960s, its landings have declined by over 90% compared to the beginning of the 2000s. However, eel landings in freshwaters have remained steady[1][2].
  • Common Name: European eel
  • NCBI Taxonomy

Silvering

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
L13[1] Ribosomal protein L13
  • Female eels showing different silver indexes
  • Different seasons
  • Hepatocytes
 eeel2_c1081
  • F:AAAGGAAGCGTATGGTGGTG
  • R:CGGTCTTCTTCTTGCCGTAG
 180 60 SYBR
ARP[1] Acidic ribosomal protein
  • Female eels showing different silver indexes
  • Different seasons
  • Hepatocytes
 AY763793
  • F:GTGCCAGCTCAGAACACTG
  • R:ACATCGCTCAAGACTTCAATGG
 107 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Elena Fabbri
  • Email: silvia.franzellitti@unibo.it
  • Institution: University of Bologna, Department of Biological, Geological, and Environmental Sciences, via Selmi 3, 40100 Bologna Italy

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 Franzellitti S, Kiwan A, Valbonesi P, Fabbri E (2015) Selection of best-performing reference gene products for investigating transcriptional regulation across silvering in the European eel (Anguilla anguilla). Sci Rep 5, 16966.
  2. ↑ Silm M, Bernotas P, Haldna M, Jarvalt A, Noges T (2017) Age and growth of European eel, Anguilla Anguilla (Linnaeus, 1758), in Estonian lakes. Journal of Applied Ichthyology 33, 236-241.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Anguilla_anguilla&oldid=8674"