Anguilla anguilla

From ICG
Jump to navigation Jump to search

Description

Anguilla anguilla.png
  • The European eel (Anguilla anguilla) is a catadromous teleost, which exhibits a complex life cycle with spawning in the ocean and growing up in continental waters. After spawning in the Sargasso Sea, within the North Atlantic gyre, eel larvae follow the Atlantic currents towards continental waters of Europe and North Africa, where they metamorphose into glass eels.
  • After reaching coastal waters, estuaries, lagoons, rivers and lakes, they turn into yellow (sexually immature) eels and remain for several years in continental waters until they undergo a pre-pubertal secondary metamorphosis called silvering and transform into silver eels. The silver eels migrate back to spawning grounds, where they eventually mate and die.
  • Eel landings have decreased rapidly throughout Europe since the 1960s (ICES, 2014). The same applies for the coastal waters of Estonia, where eel landings have declined by over 90% compared to the beginning of the 2000s. However, eel landings in freshwaters have remained steady for the past 5 years (averaging 15 tonnes/year; ICES, 2015), as these populations rely completely on stocking.[1] [2].
  • Common Name: European eel
  • NCBI Taxonomy

Silvering

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
L13[1] Ribosomal protein L13
  • Universal reference gene
eeel2_c1081
  • F:AAAGGAAGCGTATGGTGGTG
  • R:CGGTCTTCTTCTTGCCGTAG
180 60 SYBR
ARP[1] Acidic ribosomal protein
  • Universal reference gene
AY763793
  • F:GTGCCAGCTCAGAACACTG
  • R:ACATCGCTCAAGACTTCAATGG
107 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Elena Fabbri
  • Email: silvia.franzellitti@unibo.it
  • Institution: University of Bologna, Department of Biological, Geological, and Environmental Sciences, via Selmi 3, 40100 Bologna Italy

Citation Statistics

Cited by 3 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Franzellitti S, Kiwan A, Valbonesi P, Fabbri E (2015) Selection of best-performing reference gene products for investigating transcriptional regulation across silvering in the European eel (Anguilla anguilla). Sci Rep 5, 16966.
  2. Silm M, Bernotas P, Haldna M, Jarvalt A, Noges T (2017) Age and growth of European eel, Anguilla Anguilla (Linnaeus, 1758), in Estonian lakes. Journal of Applied Ichthyology 33, 236-241.