Difference between revisions of "Aphis gossypii"

From ICG
Jump to navigation Jump to search
Line 94: Line 94:
 
*'''Institution''': Department of Entomology, China Agricultural University, Beijing 100193, People’s Republic of China
 
*'''Institution''': Department of Entomology, China Agricultural University, Beijing 100193, People’s Republic of China
  
==Citation Statistics==
+
===Citation Statistics===
 
Cited by '''5''' (Based on Google Scholar [2017-06-01])
 
Cited by '''5''' (Based on Google Scholar [2017-06-01])
  

Revision as of 15:49, 20 June 2017

Description

REFqPCR2017011-1.jpg
  • Aphis gossypii is a tiny insect or greenfly in the superfamily Aphidoidea in the order Hemiptera. It is a true bug and sucks sap from plants. It is a widely distributed pest of a variety of agricultural crops in the families Cucurbitaceae, Rutaceae and Malvaceae. Common names include cotton aphid, melon aphid and melon and cotton aphid.
  • Aphis gossypii (Glover) (Hemiptera: Aphididae), the cotton aphid, is an important pest of a number of agriculturally important crops, causing damage through feeding and virus transmission. The cotton aphid control is primarily dependent on the application of insecticides, often with multiple applications each year in China. [1] [2].

Various Experimental Conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1α[1] Elongation factor 1 alpha,partial cds
  • Divergent developmental stages
  • Different geographical populations
EU019874.1
  • F:GAAGCCTGGTATGGTTGTCGT
  • R:GAAGCCTGGTATGGTTGTCGT
187 60 SYBR
β-ACT[1] Aphis gossypii beta-actin mRNA, complete cds.
  • Divergent developmental stages
  • Different geographical populations
KF018928.1
  • F:TCTTGGGAATGGAATCTTGC
  • R:TCTTGGGAATGGAATCTTGC
254 60 SYBR
RPL7[1] ribosomal protein L7
  • Divergent developmental stages
  • Experiments of the temperature changes
KP676382
  • F:TGCCGGAGTCTGTACTCAA
  • R:TGCCGGAGTCTGTACTCAA
255 60 SYBR
GAPDH[1] glyceraldehyde-3-phosphate dehydrogenase
  • Experiments of the temperature changes
KP676380
  • F:ACTACTGTTCATGCAACCACCG
  • R:ACTACTGTTCATGCAACCACCG
272 60 SYBR
18S[1] 18S ribosomal, partial sequence
  • Feeding assay experiments
KF018922.1
  • F:ATTGACGGAAGGGCACC
  • R:ATTGACGGAAGGGCACC
157 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xi-Wu Gao
  • Email: gaoxiwu@263.net.cn
  • Institution: Department of Entomology, China Agricultural University, Beijing 100193, People’s Republic of China

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Ma KS, Li F, Liang PZ, et al. (2016) Identification and Validation of Reference Genes for the Normalization of Gene Expression Data in qRT-PCR Analysis in Aphis gossypii (Hemiptera: Aphididae). J Insect Sci 16.
  2. Cao CW, Zhang J, Gao XW, Liang P, Guo HL (2008) Overexpression of carboxylesterase gene associated with organophosphorous insecticide resistance in cotton aphids, Aphis gossypii (Glover). Pesticide Biochemistry and Physiology 90, 175-180.