Difference between revisions of "Aphis gossypii"

From ICG
Jump to navigation Jump to search
 
(25 intermediate revisions by 7 users not shown)
Line 1: Line 1:
  
 
==Description==
 
==Description==
[[File:REFqPCR2017011-1.jpg|right|227px|]]
+
[[File:Aphis gossypii.png|right|200px|link=Aphis gossypii]]
* Aphis gossypii is a tiny insect or greenfly in the superfamily Aphidoidea in the order Hemiptera. It is a true bug and sucks sap from plants. It is a widely distributed pest of a variety of agricultural crops in the families Cucurbitaceae, Rutaceae and Malvaceae. Common names include cotton aphid, melon aphid and melon and cotton aphid.
+
* '''''Aphis gossypii''''', the cotton aphid, is a tiny greenfly that sucks sap from plants. It belongs to the superfamily Aphidoidea in the order Hemiptera. It is a widely distributed pest of a variety of agriculturally important crops in the families Cucurbitaceae, Rutaceae and Malvaceae, causing damage through feeding and virus transmission. The cotton aphid control is primarily dependent on the application of insecticides, often with multiple applications each year in China <ref name="ref1"/> <ref name="ref2"/>.
* Aphis gossypii (Glover) (Hemiptera: Aphididae), the cotton aphid, is an important pest of a number of agriculturally important crops, causing damage through feeding and virus transmission. The cotton aphid control is primarily dependent on the application of insecticides, often with multiple applications each year in China. <ref name="ref1"/> <ref name="ref2"/>.
+
* <font color=blue>'''Common Name:'''</font> '''Greenfly''', '''Cotton aphid''', '''Melon aphid'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=80765 <font color=blue>'''NCBI Taxonomy'''</font>]
  
=='''''Various Experimental Conditions'''''==
+
=='''''Different Developmental Stages & Geographical Populations'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 14:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 19: Line 20:
 
|-
 
|-
 
|align="center"| EF1α<ref name="ref1"/>
 
|align="center"| EF1α<ref name="ref1"/>
|align="center"| Elongation factor 1 alpha,partial cds
+
|align="center"| Elongation factor 1 alpha
 
|
 
|
 
* Divergent developmental stages
 
* Divergent developmental stages
Line 26: Line 27:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GAAGCCTGGTATGGTTGTCGT
 
* F:GAAGCCTGGTATGGTTGTCGT
* R:GAAGCCTGGTATGGTTGTCGT
+
* R:GGGTGGGTTGTTCTTTGTG
 
|align="center"|  187  
 
|align="center"|  187  
 
|align="center"| 60
 
|align="center"| 60
Line 32: Line 33:
 
|-
 
|-
 
|align="center"| β-ACT<ref name="ref1"/>
 
|align="center"| β-ACT<ref name="ref1"/>
|align="center"| Aphis gossypii beta-actin mRNA, complete cds.
+
|align="center"| beta-actin  
 
|
 
|
 
* Divergent developmental stages
 
* Divergent developmental stages
Line 39: Line 40:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TCTTGGGAATGGAATCTTGC
 
* F:TCTTGGGAATGGAATCTTGC
* R:TCTTGGGAATGGAATCTTGC
+
* R:GGACAGAGAAGCCAAGATGG
 
|align="center"|  254  
 
|align="center"|  254  
 
|align="center"| 60
 
|align="center"| 60
Line 45: Line 46:
 
|-
 
|-
 
|align="center"| RPL7<ref name="ref1"/>
 
|align="center"| RPL7<ref name="ref1"/>
|align="center"| ribosomal protein L7
+
|align="center"| Ribosomal protein L7
 
|
 
|
 
* Divergent developmental stages
 
* Divergent developmental stages
Line 52: Line 53:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TGCCGGAGTCTGTACTCAA
 
* F:TGCCGGAGTCTGTACTCAA
* R:TGCCGGAGTCTGTACTCAA
+
* R:TCACACCACGAATACGCA
 
|align="center"|  255  
 
|align="center"|  255  
 
|align="center"| 60
 
|align="center"| 60
Line 58: Line 59:
 
|-
 
|-
 
|align="center"| GAPDH<ref name="ref1"/>
 
|align="center"| GAPDH<ref name="ref1"/>
|align="center"| glyceraldehyde-3-phosphate dehydrogenase
+
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
 
* Experiments of the temperature changes
 
* Experiments of the temperature changes
Line 64: Line 65:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ACTACTGTTCATGCAACCACCG
 
* F:ACTACTGTTCATGCAACCACCG
* R:ACTACTGTTCATGCAACCACCG
+
* R:GCTGCTTCCTTAACCTTATCCT
 
|align="center"|  272  
 
|align="center"|  272  
 
|align="center"| 60
 
|align="center"| 60
Line 70: Line 71:
 
|-
 
|-
 
|align="center"| 18S<ref name="ref1"/>
 
|align="center"| 18S<ref name="ref1"/>
|align="center"| 18S ribosomal, partial sequence
+
|align="center"| 18S ribosomal
 
|
 
|
 
* Feeding assay experiments
 
* Feeding assay experiments
Line 76: Line 77:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ATTGACGGAAGGGCACC
 
* F:ATTGACGGAAGGGCACC
* R:ATTGACGGAAGGGCACC
+
* R:CGCTCCACCAACTAAGAACG
 
|align="center"|  157  
 
|align="center"|  157  
 
|align="center"| 60
 
|align="center"| 60
Line 82: Line 83:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 
===Evaluation Methods===  
 
===Evaluation Methods===  
Line 94: Line 95:
 
*'''Institution''': Department of Entomology, China Agricultural University, Beijing 100193, People’s Republic of China
 
*'''Institution''': Department of Entomology, China Agricultural University, Beijing 100193, People’s Republic of China
  
==Citation Statistics==
+
===Citation Statistics===
Cited by '''5''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=11201290449524656514&as_sdt=2005&sciodt=0,5&hl=en '''7'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 107: Line 108:
 
</references>
 
</references>
  
 +
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
[[Category:mRNA]] 
+
[[Category:mRNA]]
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 
[[Category:18S rRNA]] [[Category:ACT]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:RPL]]
 
[[Category:18S rRNA]] [[Category:ACT]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:RPL]]
 +
[[Category:Different Developmental Stages]]  [[Category:Geographical Populations]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 06:11, 1 September 2017

Description

Aphis gossypii.png
  • Aphis gossypii, the cotton aphid, is a tiny greenfly that sucks sap from plants. It belongs to the superfamily Aphidoidea in the order Hemiptera. It is a widely distributed pest of a variety of agriculturally important crops in the families Cucurbitaceae, Rutaceae and Malvaceae, causing damage through feeding and virus transmission. The cotton aphid control is primarily dependent on the application of insecticides, often with multiple applications each year in China [1] [2].
  • Common Name: Greenfly, Cotton aphid, Melon aphid
  • NCBI Taxonomy

Different Developmental Stages & Geographical Populations

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1α[1] Elongation factor 1 alpha
  • Divergent developmental stages
  • Different geographical populations
EU019874.1
  • F:GAAGCCTGGTATGGTTGTCGT
  • R:GGGTGGGTTGTTCTTTGTG
187 60 SYBR
β-ACT[1] beta-actin
  • Divergent developmental stages
  • Different geographical populations
KF018928.1
  • F:TCTTGGGAATGGAATCTTGC
  • R:GGACAGAGAAGCCAAGATGG
254 60 SYBR
RPL7[1] Ribosomal protein L7
  • Divergent developmental stages
  • Experiments of the temperature changes
KP676382
  • F:TGCCGGAGTCTGTACTCAA
  • R:TCACACCACGAATACGCA
255 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Experiments of the temperature changes
KP676380
  • F:ACTACTGTTCATGCAACCACCG
  • R:GCTGCTTCCTTAACCTTATCCT
272 60 SYBR
18S[1] 18S ribosomal
  • Feeding assay experiments
KF018922.1
  • F:ATTGACGGAAGGGCACC
  • R:CGCTCCACCAACTAAGAACG
157 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xi-Wu Gao
  • Email: gaoxiwu@263.net.cn
  • Institution: Department of Entomology, China Agricultural University, Beijing 100193, People’s Republic of China

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Ma KS, Li F, Liang PZ, et al. (2016) Identification and Validation of Reference Genes for the Normalization of Gene Expression Data in qRT-PCR Analysis in Aphis gossypii (Hemiptera: Aphididae). J Insect Sci 16.
  2. Cao CW, Zhang J, Gao XW, Liang P, Guo HL (2008) Overexpression of carboxylesterase gene associated with organophosphorous insecticide resistance in cotton aphids, Aphis gossypii (Glover). Pesticide Biochemistry and Physiology 90, 175-180.

Categories