Difference between revisions of "Apis mellifera"

From ICG
Jump to navigation Jump to search
 
(5 intermediate revisions by 3 users not shown)
Line 6: Line 6:
  
 
=='''''Bacterial Challenge'''''==
 
=='''''Bacterial Challenge'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 21: Line 21:
 
|align="center"| Actin  
 
|align="center"| Actin  
 
|
 
|
* Universal reference gene
+
* Head
 +
* Bacterial challenge with ''Escherichis coli''
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB023025 '''AB023025''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB023025 '''AB023025''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 33: Line 34:
 
|align="center"| GAPDH  
 
|align="center"| GAPDH  
 
|
 
|
* Universal reference gene
+
* Head
 +
* Bacterial challenge with ''Escherichis coli''
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_393605 '''XM_393605''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_393605 '''XM_393605''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 45: Line 47:
 
|align="center"| RPS18  
 
|align="center"| RPS18  
 
|
 
|
* Universal reference gene
+
* Head
 +
* Bacterial challenge with ''Escherichis coli''
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_625101 '''XM_625101''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_625101 '''XM_625101''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 67: Line 70:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''145''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=1788032570351657373&as_sdt=2005&sciodt=0,5&hl=en '''150'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 78: Line 81:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
Line 84: Line 87:
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 
[[Category:ACT]] [[Category:GAPDH]] [[Category:RPS]][[Category:Biotic Stress]]  [[Category:Pathological conditions]]  [[Category:Bacterial Infection]]
 
[[Category:ACT]] [[Category:GAPDH]] [[Category:RPS]][[Category:Biotic Stress]]  [[Category:Pathological conditions]]  [[Category:Bacterial Infection]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 06:13, 1 September 2017

Description

Apis mellifera.png
  • Apis mellifera is the most important managed pollinator species in the world, its pollination services are estimated at contributing $14 billion annually to the economy. Honeybees are critical for agricultural ecosystems, but are exposed to many biotic stressors including bacteria, viruses and fungi. Honey bee is also a highly social insect and represents a key model for social behavior studies. It is also the first hymenopteran insect to have its genome fully sequenced[1][2].
  • Common Name: Honeybee
  • NCBI Taxonomy

Bacterial Challenge

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Act[1] Actin
  • Head
  • Bacterial challenge with Escherichis coli
AB023025
  • F:TGCCAACACTGTCCTTTCTG
  • R:AGAATTGACCCACCAATCCA
155 61 SYBR
GAPDH[1] GAPDH
  • Head
  • Bacterial challenge with Escherichis coli
XM_393605
  • F:GATGCACCCATGTTTGTTTG
  • R:TTTGCAGAAGGTGCATCAAC
203 61 SYBR
RPS18 [1] RPS18
  • Head
  • Bacterial challenge with Escherichis coli
XM_625101
  • F:GATTCCCGATTGGTTTTTGA
  • R:CCCAATAATGACGCAAACCT
149 61 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Bieke Scharlaken
  • Email: Bieke.Scharlaken@UGent.be
  • Institution: Laboratory of Zoophysiology, Department of Biochemistry, Physiology and Microbiology, Faculty of Science, Ghent University, Belgium

Citation Statistics

Cited by 150 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Bieke Scharlaken, Dirk C. de Graaf, Karen Goossens, Marleen Brunain, Luc J. Peelman, Frans J. Jacobs. Reference Gene Selection for Insect Expression Studies Using Quantitative Real-Time PCR: The Head of the Honeybee, Apis mellifera, After a Bacterial Challenge[J]. Journal of Insect Science, 2008, 8(33):1-10.
  2. Mao W, Schuler M A, Berenbaum M R. Honey constituents up-regulate detoxification and immunity genes in the western honey bee Apis mellifera[J]. Proceedings of the National Academy of Sciences of the United States of America, 2013, 110(22):8842-6.

Categories