Difference between revisions of "Apis mellifera"

From ICG
Jump to navigation Jump to search
Line 68: Line 68:
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
Scharlaken B, de Graaf D C, Goossens K, et al. Reference gene selection for insect expression studies using quantitative real-time PCR: The head of the honeybee, Apis mellifera, after a bacterial challenge[J]. Journal of insect Science, 2008, 8(33): 1-10.
+
Bieke Scharlaken, Dirk C. de Graaf, Karen Goossens, Marleen Brunain, Luc J. Peelman, Frans J. Jacobs. Reference Gene Selection for Insect Expression Studies Using Quantitative Real-Time PCR: The Head of the Honeybee, Apis mellifera, After a Bacterial Challenge[J]. Journal of Insect Science, 2008, 8(33):1-10.
 +
</ref>
 +
<ref name="ref2">
 +
Mao W, Schuler M A, Berenbaum M R. Honey constituents up-regulate detoxification and immunity genes in the western honey bee Apis mellifera[J]. Proceedings of the National Academy of Sciences of the United States of America, 2013, 110(22):8842-6.
 
</ref>
 
</ref>
 
</references>
 
</references>

Revision as of 06:28, 17 June 2017

Description

REFqPCR200801.jpg
  • The western honey bee Apis mellifera is the most important managed pollinator species in the world; in the United States, its pollination services are estimated at contributing $14 billion annually to the economy.
  • Honeybees (Apis mellifera), are critical for agricultural ecosystems, but are exposed to many biotic stressors including bacteria, viruses and fungi.[1] [2].

Bacterial Challenge

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
actin[1] actin
  • Universal reference gene
AB023025
  • F:TGCCAACACTGTCCTTTCTG
  • R:AGAATTGACCCACCAATCCA
155 61 SYBR
GAPDH[1] GAPDH
  • Universal reference gene
XM_393605
  • F:GATGCACCCATGTTTGTTTG
  • R:TTTGCAGAAGGTGCATCAAC
203 61 SYBR
RPS18 [1] RPS18
  • Universal reference gene
XM_625101
  • F:GATTCCCGATTGGTTTTTGA
  • R:CCCAATAATGACGCAAACCT
149 61 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Bieke Scharlaken
  • Email: Bieke.Scharlaken@UGent.be
  • Institution: Laboratory of Zoophysiology, Department of Biochemistry, Physiology and Microbiology, Faculty of Science, Ghent University, Belgium

References

  1. 1.0 1.1 1.2 1.3 Bieke Scharlaken, Dirk C. de Graaf, Karen Goossens, Marleen Brunain, Luc J. Peelman, Frans J. Jacobs. Reference Gene Selection for Insect Expression Studies Using Quantitative Real-Time PCR: The Head of the Honeybee, Apis mellifera, After a Bacterial Challenge[J]. Journal of Insect Science, 2008, 8(33):1-10.
  2. Mao W, Schuler M A, Berenbaum M R. Honey constituents up-regulate detoxification and immunity genes in the western honey bee Apis mellifera[J]. Proceedings of the National Academy of Sciences of the United States of America, 2013, 110(22):8842-6.