Apis mellifera

Description

Apis mellifera is the most important managed pollinator species in the world, its pollination services are estimated at contributing $14 billion annually to the economy. Honeybees are critical for agricultural ecosystems, but are exposed to many biotic stressors including bacteria, viruses and fungi. Honey bee is also a highly social insect and represents a key model for social behavior studies. It is also the first hymenopteran insect to have its genome fully sequenced^[1]^[2].
Common Name: Honeybee
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Act^[1]	Actin	Head Bacterial challenge with Escherichis coli	AB023025	F:TGCCAACACTGTCCTTTCTG R:AGAATTGACCCACCAATCCA	155	61	SYBR
GAPDH^[1]	GAPDH	Head Bacterial challenge with Escherichis coli	XM_393605	F:GATGCACCCATGTTTGTTTG R:TTTGCAGAAGGTGCATCAAC	203	61	SYBR
RPS18 ^[1]	RPS18	Head Bacterial challenge with Escherichis coli	XM_625101	F:GATTCCCGATTGGTTTTTGA R:CCCAATAATGACGCAAACCT	149	61	SYBR

Name: Bieke Scharlaken
Email: Bieke.Scharlaken@UGent.be
Institution: Laboratory of Zoophysiology, Department of Biochemistry, Physiology and Microbiology, Faculty of Science, Ghent University, Belgium

Cited by 145 (Based on Google Scholar [2017-06-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Bieke Scharlaken, Dirk C. de Graaf, Karen Goossens, Marleen Brunain, Luc J. Peelman, Frans J. Jacobs. Reference Gene Selection for Insect Expression Studies Using Quantitative Real-Time PCR: The Head of the Honeybee, Apis mellifera, After a Bacterial Challenge[J]. Journal of Insect Science, 2008, 8(33):1-10.
↑ Mao W, Schuler M A, Berenbaum M R. Honey constituents up-regulate detoxification and immunity genes in the western honey bee Apis mellifera[J]. Proceedings of the National Academy of Sciences of the United States of America, 2013, 110(22):8842-6.