Apis mellifera

From ICG
Jump to navigation Jump to search

Description

REFqPCR200801.jpg
  • The western honey bee Apis mellifera is the most important managed pollinator species in the world; in the United States, its pollination services are estimated at contributing $14 billion annually to the economy.
  • Honeybees (Apis mellifera), are critical for agricultural ecosystems, but are exposed to many biotic stressors including bacteria, viruses and fungi.[1] [2].

Bacterial Challenge

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
actin[1] actin
  • Universal reference gene
AB023025
  • F:TGCCAACACTGTCCTTTCTG
  • R:AGAATTGACCCACCAATCCA
155 61 SYBR
GAPDH[1] GAPDH
  • Universal reference gene
XM_393605
  • F:GATGCACCCATGTTTGTTTG
  • R:TTTGCAGAAGGTGCATCAAC
203 61 SYBR
RPS18 [1] RPS18
  • Universal reference gene
XM_625101
  • F:GATTCCCGATTGGTTTTTGA
  • R:CCCAATAATGACGCAAACCT
149 61 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Bieke Scharlaken
  • Email: Bieke.Scharlaken@UGent.be
  • Institution: Laboratory of Zoophysiology, Department of Biochemistry, Physiology and Microbiology, Faculty of Science, Ghent University, Belgium

References

  1. 1.0 1.1 1.2 1.3 Scharlaken B, de Graaf D C, Goossens K, et al. Reference gene selection for insect expression studies using quantitative real-time PCR: The head of the honeybee, Apis mellifera, after a bacterial challenge[J]. Journal of insect Science, 2008, 8(33): 1-10.
  2. Cite error: Invalid <ref> tag; no text was provided for refs named ref2