Difference between revisions of "Arabidopsis thaliana"

From ICG
Jump to navigation Jump to search
Line 80: Line 80:
 
</references>
 
</references>
 
[[Category:Plants]]
 
[[Category:Plants]]
 +
[[Category:mRNA]] 
 +
[[Category:SYBR]]

Revision as of 03:21, 19 June 2017

Description

REFqPCRArabidopsis thaliana.jpg
  • Arabidopsis is a flowering plant that has been used in classical genetic work for over 70 years and that has an extensive genetic and ecological literature.
  • The plant is a member of the mustard family, along with some more familiar plants, such as cabbages and radishes. It is a harmless weed of no food or other economic value. Nonetheless, the literature on the plant indicates that for several reasons, Arabidopsis may be of considerable value in molecular genetic research. The plant is well suited to classical genetic work: it has a generation time of only 5 weeks; it can produce more than 10,000 seeds per plant; and it is of such small size that dozens can be grown in a small pot, and tens of thousands can be grown in a small room.
  • It requires only moist soil and fluorescent light for rapid growth. The small flowers contain both anthers and pistils, and the plant typically self-fertilizes. Self-fertilization allows new mutations to be made homozygous with minimal effort. When desired, cross-fertilization can be simply and rapidly effected, thereby making possible the crosses necessary for genetic mapping and for the production of multiple mutant stocks. Mutagenesis can be performed by soaking seeds in chemical mutagens such as ethyl methanesulfonate or by irradiating of seeds soaked in water. The mutagenized seeds are planted, grown to maturity, and allowed to self-fertilize, thereby producing seeds that are homozygous for new mutations[1].

Iron Deficiency

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
SAND[2] SAND family protein
  • Iron deficiency
AK118037
  • F:AACTCTATGCAGCATTTGATCCACT
  • R:TGATTGCATATCTTTATCGCCATC
60 SYBR
YLS8[2] Mitosis protein YLS8
  • Iron deficiency
AF324685
  • F:TTACTGTTTCGGTTGTTCTCCATTT
  • R:CACTGAATCATGTTCGAAGCAAGT
60 SYBR
TIP41-like[2] TIP41-like family protein
  • Iron deficiency
AY091389
  • F:GTGAAAACTGTTGGAGAGAAGCAA
  • R:TCAACTGGATACCCTTTCGCA
60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Bin Han
  • Email: wbshenh@njau.edu.cn
  • Institute: College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China

Citation Statistics

Cited by 18 (Based on Google Scholar [2017-06-16])

References

  1. Meyerowitz E M, Pruitt R E. Arabidopsis thaliana and plant molecular genetics[J]. Science, 1985, 229(4719): 1214-1218.
  2. 2.0 2.1 2.2 Han B, Yang Z, Samma M K, et al. Systematic validation of candidate reference genes for qRT-PCR normalization under iron deficiency in Arabidopsis[J]. Biometals, 2013, 26(3): 403-413.