Difference between revisions of "Arabidopsis thaliana"

From ICG
Jump to navigation Jump to search
Line 70: Line 70:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
[[Category:Plants]]

Revision as of 10:11, 16 June 2017

Description

Iron Deficiency

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
SAND[1] SAND family protein
  • iron deficiency
AK118037
  • F:AACTCTATGCAGCATTTGATCCACT
  • R:TGATTGCATATCTTTATCGCCATC
60 SYBR
YLS8[1] Mitosis protein YLS8
  • iron deficiency
AF324685
  • F:TTACTGTTTCGGTTGTTCTCCATTT
  • R:CACTGAATCATGTTCGAAGCAAGT
60 SYBR
TIP41-like[1] TIP41-like family protein
  • iron deficiency
AY091389
  • F:GTGAAAACTGTTGGAGAGAAGCAA
  • R:TCAACTGGATACCCTTTCGCA
60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Bin Han
  • Email: wbshenh@njau.edu.cn
  • Institute: College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China

Citation Statistics

Cited by 18 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Han B, Yang Z, Samma M K, et al. Systematic validation of candidate reference genes for qRT-PCR normalization under iron deficiency in Arabidopsis[J]. Biometals, 2013, 26(3): 403-413.