Difference between revisions of "Artemisia annua"

From ICG
Jump to navigation Jump to search
Line 81: Line 81:
 
*'''Institution''': Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), SWU-TAAHC Medicinal Plant Joint R&D Centre, School of Life Sciences, Southwest University, Chongqing 400715, China
 
*'''Institution''': Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), SWU-TAAHC Medicinal Plant Joint R&D Centre, School of Life Sciences, Southwest University, Chongqing 400715, China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''6''' (Based on Google Scholar [2017-06-16])
+
Cited by '''6''' (Based on Google Scholar [2017-08-10])
  
 
=='''References'''==
 
=='''References'''==

Revision as of 02:19, 11 August 2017

Description

Artemisia annua.png
  • Artemisia annua L., an annual plant that belongs to chrysanthemum family, its antibacterial, antiviral and antioxidant properties allow it to be used as a traditional herbalmedicine. It is primarily found in the tropical zones of Asia along streets and in fields. Since ancient times, it has been used as an antipyretic, hemostatic, as a treatment for skin diseases, and an insecticide because it contains various bioactive compounds[1][2].
  • Common Name: Sweet wormwood, Sweet annie, Sweet sagewort, Annual mugwort, Annual wormwood
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPII[1] DNA-directed RNA polymerase II subunit
  • Different organs
EY111688
  • F:TGGCATCAATCCTCATACC
  • R:AAACTGTCCTCTTTGGCATA
135 58.4 SYBR
EF1a[1] Elongation factor 1-alpha
  • Different organs
  • Temperature-shocked samples
  • Phytohormone treatment
EY045332
  • F:GACCTACTCTCCTTGAAG
  • R:GTTCCAATACCACCAATC
109 55.9 SYBR
TUB[1] Tubulin beta chain
  • Phytohormone treatment
EY110418
  • F:CATCTCCGAAGGTCTCTG
  • R:TTCATTGTCCAACACCATAC
104 60.3 SYBR
ACT[1] Actin
  • Temperature-shocked samples
EY091989
  • F:CCATTGAACACGGTATTG
  • R:AGGAACATTGAAGGTCTC
182 53.4 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhihua Liao
  • Email: zhliao@swu.edu.cn
  • Institution: Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), SWU-TAAHC Medicinal Plant Joint R&D Centre, School of Life Sciences, Southwest University, Chongqing 400715, China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-08-10])

References

  1. 1.0 1.1 1.2 1.3 1.4 Liu W, Zhao T, Wang H, et al. (2014) Reference gene selection in Artemisia annua L., a plant species producing anti-malarial artemisinin. Plant Cell, Tissue and Organ Culture (PCTOC) 121, 141-152.
  2. Kim EJ, Kim GT, Kim BM, et al. (2017) Apoptosis-induced effects of extract from Artemisia annua Linne by modulating PTEN/p53/PDK1/Akt/ signal pathways through PTEN/p53-independent manner in HCT116 colon cancer cells. Bmc Complementary and Alternative Medicine 17.

Categories