Difference between revisions of "Artemisia annua"

From ICG
Jump to navigation Jump to search
 
(5 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
 
[[File:Artemisia annua.png|right|200px|link=Artemisia annua]]
 
[[File:Artemisia annua.png|right|200px|link=Artemisia annua]]
* '''''Artemisia annua L.''''', an annual plant that belongs to chrysanthemum family, its antibacterial, antiviral and antioxidant properties allow it to be used as a traditional herbalmedicine. It is primarily found in the tropical zones of Asia along streets and in fields. Since ancient times, it has been used as an antipyretic, hemostatic, as a treatment for skin diseases, and an insecticide  because it contains various bioactive compounds<ref name="ref1"/><ref name="ref2"/>.
+
* '''''Artemisia annua L.''''', an annual plant that belongs to chrysanthemum family, its antibacterial, antiviral and antioxidant properties allow it to be used as a traditional herbalmedicine. It is primarily found in the tropical zones of Asia along streets and in fields. Since ancient times, it has been used as an antipyretic, hemostatic, as a treatment for skin diseases, and an insecticide  because it contains various bioactive compounds <ref name="ref1"/><ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Sweet wormwood''', ''' Sweet annie''', '''Sweet sagewort''', '''Annual mugwort''', '''Annual wormwood'''
 
* <font color=blue>'''Common Name:'''</font> '''Sweet wormwood''', ''' Sweet annie''', '''Sweet sagewort''', '''Annual mugwort''', '''Annual wormwood'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=35608 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=35608 <font color=blue>'''NCBI Taxonomy'''</font>]
Line 19: Line 19:
 
|-
 
|-
 
|align="center"| RPII<ref name="ref1"/>
 
|align="center"| RPII<ref name="ref1"/>
|align="center"| DNA-directed RNA polymerase II subunit
+
|align="center"| RNA polymerase II subunit
 
|
 
|
 
* Different organs
 
* Different organs
Line 81: Line 81:
 
*'''Institution''': Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), SWU-TAAHC Medicinal Plant Joint R&D Centre, School of Life Sciences, Southwest University, Chongqing 400715, China
 
*'''Institution''': Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), SWU-TAAHC Medicinal Plant Joint R&D Centre, School of Life Sciences, Southwest University, Chongqing 400715, China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''6''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=6235529103999350771&as_sdt=2005&sciodt=0,5&hl=en '''6'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
Liu W, Zhao T, Wang H, et al. (2014) Reference gene selection in Artemisia annua L., a plant species producing anti-malarial artemisinin. Plant Cell, Tissue and Organ Culture (PCTOC) 121, 141-152.
+
Liu, W., Zhao, T., Wang, H., Zeng, J., Xiang, L., Zhu, S., ... & Liao, Z. (2015). Reference gene selection in Artemisia annua L., a plant species producing anti-malarial artemisinin. Plant Cell, Tissue and Organ Culture (PCTOC), 121(1), 141-152.
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
Kim EJ, Kim GT, Kim BM, et al. (2017) Apoptosis-induced effects of extract from Artemisia annua Linne by modulating PTEN/p53/PDK1/Akt/ signal pathways through PTEN/p53-independent manner in HCT116 colon cancer cells. Bmc Complementary and Alternative Medicine 17.
+
Kim, E. J., Kim, G. T., Kim, B. M., Lim, E. G., Kim, S. Y., & Kim, Y. M. (2017). Apoptosis-induced effects of extract from Artemisia annua Linné by modulating PTEN/p53/PDK1/Akt/signal pathways through PTEN/p53-independent manner in HCT116 colon cancer cells. BMC complementary and alternative medicine, 17(1), 236.
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 
=='''Categories'''==
 
=='''Categories'''==
 
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]]
 
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]]

Latest revision as of 07:26, 1 September 2017

Description

Artemisia annua.png
  • Artemisia annua L., an annual plant that belongs to chrysanthemum family, its antibacterial, antiviral and antioxidant properties allow it to be used as a traditional herbalmedicine. It is primarily found in the tropical zones of Asia along streets and in fields. Since ancient times, it has been used as an antipyretic, hemostatic, as a treatment for skin diseases, and an insecticide because it contains various bioactive compounds [1][2].
  • Common Name: Sweet wormwood, Sweet annie, Sweet sagewort, Annual mugwort, Annual wormwood
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPII[1] RNA polymerase II subunit
  • Different organs
EY111688
  • F:TGGCATCAATCCTCATACC
  • R:AAACTGTCCTCTTTGGCATA
135 58.4 SYBR
EF1a[1] Elongation factor 1-alpha
  • Different organs
  • Temperature-shocked samples
  • Phytohormone treatment
EY045332
  • F:GACCTACTCTCCTTGAAG
  • R:GTTCCAATACCACCAATC
109 55.9 SYBR
TUB[1] Tubulin beta chain
  • Phytohormone treatment
EY110418
  • F:CATCTCCGAAGGTCTCTG
  • R:TTCATTGTCCAACACCATAC
104 60.3 SYBR
ACT[1] Actin
  • Temperature-shocked samples
EY091989
  • F:CCATTGAACACGGTATTG
  • R:AGGAACATTGAAGGTCTC
182 53.4 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhihua Liao
  • Email: zhliao@swu.edu.cn
  • Institution: Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), SWU-TAAHC Medicinal Plant Joint R&D Centre, School of Life Sciences, Southwest University, Chongqing 400715, China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Liu, W., Zhao, T., Wang, H., Zeng, J., Xiang, L., Zhu, S., ... & Liao, Z. (2015). Reference gene selection in Artemisia annua L., a plant species producing anti-malarial artemisinin. Plant Cell, Tissue and Organ Culture (PCTOC), 121(1), 141-152.
  2. Kim, E. J., Kim, G. T., Kim, B. M., Lim, E. G., Kim, S. Y., & Kim, Y. M. (2017). Apoptosis-induced effects of extract from Artemisia annua Linné by modulating PTEN/p53/PDK1/Akt/signal pathways through PTEN/p53-independent manner in HCT116 colon cancer cells. BMC complementary and alternative medicine, 17(1), 236.

Categories