Difference between revisions of "Artemisia annua"

From ICG
Jump to navigation Jump to search
(Created page with "==Description== right|327px| * Artemisia annua L., namely sweet wormwood, has received increasing attention due to the fact that the plant produc...")
 
 
(24 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
−
[[File:REFqPCR2014022-1.jpg|right|327px|]]
+
[[File:Artemisia annua.png|right|200px|link=Artemisia annua]]
−
* Artemisia annua L., namely sweet wormwood, has received increasing attention due to the fact that the plant produces the sesquiterpenoid endoperoxide artemisinin, which today is widely used in the treatment of malaria.
+
* '''''Artemisia annua L.''''', an annual plant that belongs to chrysanthemum family, its antibacterial, antiviral and antioxidant properties allow it to be used as a traditional herbalmedicine. It is primarily found in the tropical zones of Asia along streets and in fields. Since ancient times, it has been used as an antipyretic, hemostatic, as a treatment for skin diseases, and an insecticide because it contains various bioactive compounds <ref name="ref1"/><ref name="ref2"/>.
−
* Malaria is an infectious disease which is seriously harmful to human health with an estimated number of 400 million infections and more than 1 million deaths per year around the world. Artemisia annua Linné is an annual plant that is chrysanthemum family. This plant is primarily found in the tropical zones of Asia along streets and in fields. Since ancient times, Artemisia annua Linné has been used as an antipyretic, hemostatic, as a treatment for skin diseases, and an insecticide.
+
* <font color=blue>'''Common Name:'''</font> '''Sweet wormwood''', ''' Sweet annie''', '''Sweet sagewort''', '''Annual mugwort''', '''Annual wormwood'''
−
* In addition, its antibacterial, antiviral and antioxidant properties allow it has been used as a traditional herbalmedicine. This plant also contains various bioactive compounds. Artemisinin, the main element of sweet wormwood, is being used for medical uses, such as anti-malarial activity. <ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=35608 <font color=blue>'''NCBI Taxonomy'''</font>]
  
−
=='''''Phytohormones & Abiotic Stresses'''''==
+
=='''''Different Tissues & Abiotic Stress'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 13:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 19: Line 19:
 
|-
 
|-
 
|align="center"| RPII<ref name="ref1"/>
 
|align="center"| RPII<ref name="ref1"/>
−
|align="center"| DNA-directed RNA polymerase II subunit
+
|align="center"| RNA polymerase II subunit
 
|
 
|
 
* Different organs
 
* Different organs
−
|align="center"| [https://www.ncbi.nlm.nih.gov/gquery/?term=EY111688 '''EY111688''']  
+
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/EY111688 '''EY111688''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TGGCATCAATCCTCATACC
 
* F:TGGCATCAATCCTCATACC
Line 34: Line 34:
 
|
 
|
 
* Different organs
 
* Different organs
−
* Temperature- shocked samples
+
* Temperature-shocked samples
 
* Phytohormone treatment
 
* Phytohormone treatment
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/EY045332 '''EY045332''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/EY045332 '''EY045332''']  
Line 69: Line 69:
 
|}
 
|}
  
−
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 79: Line 80:
 
*'''Email''': zhliao@swu.edu.cn
 
*'''Email''': zhliao@swu.edu.cn
 
*'''Institution''': Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), SWU-TAAHC Medicinal Plant Joint R&D Centre, School of Life Sciences, Southwest University, Chongqing 400715, China
 
*'''Institution''': Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), SWU-TAAHC Medicinal Plant Joint R&D Centre, School of Life Sciences, Southwest University, Chongqing 400715, China
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=6235529103999350771&as_sdt=2005&sciodt=0,5&hl=en '''6'''] (Based on Google Scholar [2017-09-01])
 +
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
−
Liu W, Zhao T, Wang H, et al. (2014) Reference gene selection in Artemisia annua L., a plant species producing anti-malarial artemisinin. Plant Cell, Tissue and Organ Culture (PCTOC) 121, 141-152.
+
Liu, W., Zhao, T., Wang, H., Zeng, J., Xiang, L., Zhu, S., ... & Liao, Z. (2015). Reference gene selection in Artemisia annua L., a plant species producing anti-malarial artemisinin. Plant Cell, Tissue and Organ Culture (PCTOC), 121(1), 141-152.
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
−
Kim EJ, Kim GT, Kim BM, et al. (2017) Apoptosis-induced effects of extract from Artemisia annua Linne by modulating PTEN/p53/PDK1/Akt/ signal pathways through PTEN/p53-independent manner in HCT116 colon cancer cells. Bmc Complementary and Alternative Medicine 17.
+
Kim, E. J., Kim, G. T., Kim, B. M., Lim, E. G., Kim, S. Y., & Kim, Y. M. (2017). Apoptosis-induced effects of extract from Artemisia annua Linné by modulating PTEN/p53/PDK1/Akt/signal pathways through PTEN/p53-independent manner in HCT116 colon cancer cells. BMC complementary and alternative medicine, 17(1), 236.
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 +
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]]
 +
[[Category:ACT]] [[Category:EF1α]] [[Category:polA]] [[Category:Tubulin]]
 +
[[Category:Hormone Treatment]]  [[Category:Different Tissues]]  [[Category:Abiotic Stress]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 07:26, 1 September 2017

Description

Artemisia annua.png
  • Artemisia annua L., an annual plant that belongs to chrysanthemum family, its antibacterial, antiviral and antioxidant properties allow it to be used as a traditional herbalmedicine. It is primarily found in the tropical zones of Asia along streets and in fields. Since ancient times, it has been used as an antipyretic, hemostatic, as a treatment for skin diseases, and an insecticide because it contains various bioactive compounds [1][2].
  • Common Name: Sweet wormwood, Sweet annie, Sweet sagewort, Annual mugwort, Annual wormwood
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
RPII[1] RNA polymerase II subunit
  • Different organs
 EY111688
  • F:TGGCATCAATCCTCATACC
  • R:AAACTGTCCTCTTTGGCATA
 135 58.4 SYBR
EF1a[1] Elongation factor 1-alpha
  • Different organs
  • Temperature-shocked samples
  • Phytohormone treatment
 EY045332
  • F:GACCTACTCTCCTTGAAG
  • R:GTTCCAATACCACCAATC
 109 55.9 SYBR
TUB[1] Tubulin beta chain
  • Phytohormone treatment
 EY110418
  • F:CATCTCCGAAGGTCTCTG
  • R:TTCATTGTCCAACACCATAC
 104 60.3 SYBR
ACT[1] Actin
  • Temperature-shocked samples
 EY091989
  • F:CCATTGAACACGGTATTG
  • R:AGGAACATTGAAGGTCTC
 182 53.4 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhihua Liao
  • Email: zhliao@swu.edu.cn
  • Institution: Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), SWU-TAAHC Medicinal Plant Joint R&D Centre, School of Life Sciences, Southwest University, Chongqing 400715, China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 Liu, W., Zhao, T., Wang, H., Zeng, J., Xiang, L., Zhu, S., ... & Liao, Z. (2015). Reference gene selection in Artemisia annua L., a plant species producing anti-malarial artemisinin. Plant Cell, Tissue and Organ Culture (PCTOC), 121(1), 141-152.
  2. ↑ Kim, E. J., Kim, G. T., Kim, B. M., Lim, E. G., Kim, S. Y., & Kim, Y. M. (2017). Apoptosis-induced effects of extract from Artemisia annua Linné by modulating PTEN/p53/PDK1/Akt/signal pathways through PTEN/p53-independent manner in HCT116 colon cancer cells. BMC complementary and alternative medicine, 17(1), 236.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Artemisia_annua&oldid=8775"