Artemisia annua

From ICG
Jump to navigation Jump to search

Description

REFqPCR2014022-1.jpg
  • Artemisia annua L., namely sweet wormwood, has received increasing attention due to the fact that the plant produces the sesquiterpenoid endoperoxide artemisinin, which today is widely used in the treatment of malaria.
  • Malaria is an infectious disease which is seriously harmful to human health with an estimated number of 400 million infections and more than 1 million deaths per year around the world. Artemisia annua Linné is an annual plant that is chrysanthemum family. This plant is primarily found in the tropical zones of Asia along streets and in fields. Since ancient times, Artemisia annua Linné has been used as an antipyretic, hemostatic, as a treatment for skin diseases, and an insecticide.
  • In addition, its antibacterial, antiviral and antioxidant properties allow it has been used as a traditional herbalmedicine. This plant also contains various bioactive compounds. Artemisinin, the main element of sweet wormwood, is being used for medical uses, such as anti-malarial activity. [1] [2].

Phytohormones & Abiotic Stresses

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPII[1] DNA-directed RNA polymerase II subunit
  • Different organs
EY111688
  • F:TGGCATCAATCCTCATACC
  • R:AAACTGTCCTCTTTGGCATA
135 58.4 SYBR
EF1a[1] Elongation factor 1-alpha
  • Different organs
  • Temperature-shocked samples
  • Phytohormone treatment
EY045332
  • F:GACCTACTCTCCTTGAAG
  • R:GTTCCAATACCACCAATC
109 55.9 SYBR
TUB[1] Tubulin beta chain
  • Phytohormone treatment
EY110418
  • F:CATCTCCGAAGGTCTCTG
  • R:TTCATTGTCCAACACCATAC
104 60.3 SYBR
ACT[1] Actin
  • Temperature-shocked samples
EY091989
  • F:CCATTGAACACGGTATTG
  • R:AGGAACATTGAAGGTCTC
182 53.4 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhihua Liao
  • Email: zhliao@swu.edu.cn
  • Institution: Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), SWU-TAAHC Medicinal Plant Joint R&D Centre, School of Life Sciences, Southwest University, Chongqing 400715, China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 Liu W, Zhao T, Wang H, et al. (2014) Reference gene selection in Artemisia annua L., a plant species producing anti-malarial artemisinin. Plant Cell, Tissue and Organ Culture (PCTOC) 121, 141-152.
  2. Kim EJ, Kim GT, Kim BM, et al. (2017) Apoptosis-induced effects of extract from Artemisia annua Linne by modulating PTEN/p53/PDK1/Akt/ signal pathways through PTEN/p53-independent manner in HCT116 colon cancer cells. Bmc Complementary and Alternative Medicine 17.