Difference between revisions of "Aspergillus niger"

Revision as of 02:08, 27 June 2017

Aspergillus niger is a member of the genus Aspergillus which includes a set of fungi that are generally considered asexual, although perfect forms (forms that reproduce sexually) have been found. Aspergilli are ubiquitous in nature. Aspergillus niger grows poorly on acetamide as a nitrogen or carbon source and lacks sequences detectably homologous to the amdS gene encoding the acetamidase of Aspergillus nidulans^[1]^[2].
Common Name: Aspergillus
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
act^[1]	Actin	Universal reference genes	AJ132229	F:GGTCTGGAGAGCGGTGGTAT R:CACTGCGAAGAAGGAGCAAGAGCAGTG	NA	60	NA
cox5^[1]	Cytochrome c oxidase subunit V	Universal reference genes	AJ132229	F:GACCAAGGAGTGGCAGGAG R: GAACTGGGTGGGAGGCAGCAGTTC	NA	60	NA

Name: K. Bohle
Email: ibvt@tu-bs.de
Institution: Technische Universität Braunschweig, Institute of Biochemical Engineering, Gaußstraße 17, D-38106 Braunschweig, Germany

Cited by 32 (Based on Google Scholar [2017-06-16])

↑ ^1.0 ^1.1 ^1.2 Bohle K, Jungebloud A, Göcke Y, et al. Selection of reference genes for normalisation of specific gene quantification data of Aspergillus niger[J]. Journal of biotechnology, 2007, 132(4): 353-358.
↑ Kelly JM, Hynes MJ. Transformation of Aspergillus niger by the amdS gene of Aspergillus nidulans. The EMBO Journal. 1985;4(2):475-479.

@@ Line 1: / Line 1: @@
 =='''Description'''==
 [[File:Aspergillus niger Micrograph.jpg|right|237px]]
-*Aspergillus niger is a fungus and one of the most common species of the genus Aspergillus.
+* Aspergillus niger is a member of the genus Aspergillus which includes a set of fungi that are generally considered asexual, although perfect forms (forms that reproduce sexually) have been found. Aspergilli are ubiquitous in nature. Aspergillus niger grows poorly on acetamide as a nitrogen or carbon source and lacks sequences detectably homologous to the amdS gene encoding the acetamidase of Aspergillus nidulans<ref name="ref1"/><ref name="ref2"/>.
-*Aspergillus niger is a member of the genus Aspergillus which includes a set of fungi that are generally considered asexual, although perfect forms (forms that reproduce sexually) have been found. Aspergilli are ubiquitous in nature.
-*Aspergillus niger grows poorly on acetamide as a nitrogen or carbon source and lacks sequences detectably homologous to the amdS gene encoding the acetamidase of Aspergillus nidulans<ref name="ref1"/><ref name="ref2"/>.
 * <font color=blue>'''Common Name:'''</font> '''Aspergillus'''
 * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=5061 <font color=blue>'''NCBI Taxonomy'''</font>]