Difference between revisions of "Aspergillus niger"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''''Continuous Cultivations'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Nam...")
 
Line 21: Line 21:
 
* F:GGTCTGGAGAGCGGTGGTAT  
 
* F:GGTCTGGAGAGCGGTGGTAT  
 
* R:cactgcGAAGAAGGAGCAAGAGCAGtG
 
* R:cactgcGAAGAAGGAGCAAGAGCAGtG
|align="center"| NA
 
|align="center"| 60
 
|align="center"| NA
 
|-
 
|align="center"| sarA<ref name="ref1"/>
 
|align="center"| Secretion associated GTP-binding protein
 
|
 
Universal reference genes
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/Z67742 '''Z67742''']
 
|nowrap style="font-size:9pt"|
 
* F:gaacctACGGGTAAGGGCAAGGtTC
 
* R: TCGCAACAATAAAGTCAACAGC
 
 
|align="center"| NA
 
|align="center"| NA
 
|align="center"| 60
 
|align="center"| 60
Line 49: Line 37:
 
|align="center"| NA
 
|align="center"| NA
 
|}
 
|}
 +
 
===Moleculer Type===
 
===Moleculer Type===
 
* mRNA
 
* mRNA

Revision as of 09:25, 16 June 2017

Description

Continuous Cultivations

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
act[1] Actin

Universal reference genes

AJ132229
  • F:GGTCTGGAGAGCGGTGGTAT
  • R:cactgcGAAGAAGGAGCAAGAGCAGtG
NA 60 NA
cox5[1] Cytochrome c oxidase subunit V

Universal reference genes

AJ132229
  • F:GACCAAGGAGTGGCAGGAG
  • R: gaactgGGTGGGAGGCAGCAGtTC
NA 60 NA

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: K. Bohle
  • Email: ibvt@tu-bs.de
  • Institution: Technische Universität Braunschweig, Institute of Biochemical Engineering, Gaußstraße 17, D-38106 Braunschweig, Germany

References

  1. 1.0 1.1 Bohle K, Jungebloud A, Göcke Y, et al. Selection of reference genes for normalisation of specific gene quantification data of Aspergillus niger[J]. Journal of biotechnology, 2007, 132(4): 353-358.