Difference between revisions of "Aspergillus niger"
Jump to navigation
Jump to search
ICG Expert3 (talk | contribs) |
Cao Jiabao (talk | contribs) |
||
(14 intermediate revisions by 6 users not shown) | |||
Line 1: | Line 1: | ||
=='''Description'''== | =='''Description'''== | ||
− | [[File:Aspergillus niger | + | [[File:Aspergillus niger.png|right|200px|link=Aspergillus niger]] |
− | *Aspergillus niger | + | * '''''Aspergillus niger''''' is a member of the genus Aspergillus which includes a set of fungi that are generally considered asexual, although perfect forms (forms that reproduce sexually) have been found. Aspergilli are ubiquitous in nature. Aspergillus niger grows poorly on acetamide as a nitrogen or carbon source and lacks sequences detectably homologous to the amdS gene encoding the acetamidase of Aspergillus nidulans<ref name="ref1"/><ref name="ref2"/>. |
− | + | * <font color=blue>'''Common Name:'''</font> '''Aspergillus''' | |
− | + | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=5061 <font color=blue>'''NCBI Taxonomy'''</font>] | |
=='''''Continuous Cultivation'''''== | =='''''Continuous Cultivation'''''== | ||
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 25: | Line 25: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GGTCTGGAGAGCGGTGGTAT | * F:GGTCTGGAGAGCGGTGGTAT | ||
− | * R: | + | * R:CACTGCGAAGAAGGAGCAAGAGCAGTG |
+ | |||
|align="center"| NA | |align="center"| NA | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 37: | Line 38: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GACCAAGGAGTGGCAGGAG | * F:GACCAAGGAGTGGCAGGAG | ||
− | * R: | + | * R: GAACTGGGTGGGAGGCAGCAGTTC |
+ | |||
|align="center"| NA | |align="center"| NA | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 43: | Line 45: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
* mRNA | * mRNA | ||
+ | |||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
* [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
Line 52: | Line 55: | ||
*'''Institution''': Technische Universität Braunschweig, Institute of Biochemical Engineering, Gaußstraße 17, D-38106 Braunschweig, Germany | *'''Institution''': Technische Universität Braunschweig, Institute of Biochemical Engineering, Gaußstraße 17, D-38106 Braunschweig, Germany | ||
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by ''' | + | Cited by [https://scholar.google.com/scholar?cites=18316331319980714875&as_sdt=2005&sciodt=0,5&hl=en '''35'''] (Based on Google Scholar [2017-09-01]) |
=='''References'''== | =='''References'''== | ||
Line 64: | Line 67: | ||
</ref> | </ref> | ||
</references> | </references> | ||
+ | |||
+ | =='''Categories'''== | ||
[[Category:Fungi]] | [[Category:Fungi]] | ||
Line 69: | Line 74: | ||
[[Category:SYBR]] | [[Category:SYBR]] | ||
− | [[Category:ACT]] [[Category: | + | [[Category:ACT]] [[Category:Cyclophilin]][[Category:Continuous Cultivation]] |
+ | |||
+ | [[Category:geNorm]] |
Latest revision as of 04:52, 1 September 2017
Contents
Description
- Aspergillus niger is a member of the genus Aspergillus which includes a set of fungi that are generally considered asexual, although perfect forms (forms that reproduce sexually) have been found. Aspergilli are ubiquitous in nature. Aspergillus niger grows poorly on acetamide as a nitrogen or carbon source and lacks sequences detectably homologous to the amdS gene encoding the acetamidase of Aspergillus nidulans[1][2].
- Common Name: Aspergillus
- NCBI Taxonomy
Continuous Cultivation
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
act[1] | Actin |
|
AJ132229 |
|
NA | 60 | NA |
cox5[1] | Cytochrome c oxidase subunit V |
|
AJ132229 |
|
NA | 60 | NA |
Molecular Types
- mRNA
Evaluation Methods
Contact
- Name: K. Bohle
- Email: ibvt@tu-bs.de
- Institution: Technische Universität Braunschweig, Institute of Biochemical Engineering, Gaußstraße 17, D-38106 Braunschweig, Germany
Citation Statistics
Cited by 35 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 Bohle K, Jungebloud A, Göcke Y, et al. Selection of reference genes for normalisation of specific gene quantification data of Aspergillus niger[J]. Journal of biotechnology, 2007, 132(4): 353-358.
- ↑ Kelly JM, Hynes MJ. Transformation of Aspergillus niger by the amdS gene of Aspergillus nidulans. The EMBO Journal. 1985;4(2):475-479.