Difference between revisions of "Aspergillus niger"

From ICG
Jump to navigation Jump to search
 
(10 intermediate revisions by 4 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:Aspergillus niger Micrograph.jpg|right|237px]]
+
[[File:Aspergillus niger.png|right|200px|link=Aspergillus niger]]
*Aspergillus niger is a fungus and one of the most common species of the genus Aspergillus.
+
* '''''Aspergillus niger''''' is a member of the genus Aspergillus which includes a set of fungi that are generally considered asexual, although perfect forms (forms that reproduce sexually) have been found. Aspergilli are ubiquitous in nature. Aspergillus niger grows poorly on acetamide as a nitrogen or carbon source and lacks sequences detectably homologous to the amdS gene encoding the acetamidase of Aspergillus nidulans<ref name="ref1"/><ref name="ref2"/>.
*Aspergillus niger is a member of the genus Aspergillus which includes a set of fungi that are generally considered asexual, although perfect forms (forms that reproduce sexually) have been found. Aspergilli are ubiquitous in nature.
+
* <font color=blue>'''Common Name:'''</font> '''Aspergillus'''
*Aspergillus niger grows poorly on acetamide as a nitrogen or carbon source and lacks sequences detectably homologous to the amdS gene encoding the acetamidase of Aspergillus nidulans<ref name="ref1"/><ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=5061 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Continuous Cultivation'''''==
 
=='''''Continuous Cultivation'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 55: Line 55:
 
*'''Institution''': Technische Universität Braunschweig, Institute of Biochemical Engineering, Gaußstraße 17, D-38106 Braunschweig, Germany
 
*'''Institution''': Technische Universität Braunschweig, Institute of Biochemical Engineering, Gaußstraße 17, D-38106 Braunschweig, Germany
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''32''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=18316331319980714875&as_sdt=2005&sciodt=0,5&hl=en '''35'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 67: Line 67:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 
[[Category:Fungi]]
 
[[Category:Fungi]]
  
Line 72: Line 74:
  
 
[[Category:SYBR]]
 
[[Category:SYBR]]
[[Category:ACT]] [[Category:COX]][[Category:Continuous Cultivation]]
+
[[Category:ACT]] [[Category:Cyclophilin]][[Category:Continuous Cultivation]]
 +
 
 +
[[Category:geNorm]]

Latest revision as of 04:52, 1 September 2017

Description

Aspergillus niger.png
  • Aspergillus niger is a member of the genus Aspergillus which includes a set of fungi that are generally considered asexual, although perfect forms (forms that reproduce sexually) have been found. Aspergilli are ubiquitous in nature. Aspergillus niger grows poorly on acetamide as a nitrogen or carbon source and lacks sequences detectably homologous to the amdS gene encoding the acetamidase of Aspergillus nidulans[1][2].
  • Common Name: Aspergillus
  • NCBI Taxonomy

Continuous Cultivation

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
act[1] Actin
  • Universal reference genes
AJ132229
  • F:GGTCTGGAGAGCGGTGGTAT
  • R:CACTGCGAAGAAGGAGCAAGAGCAGTG
NA 60 NA
cox5[1] Cytochrome c oxidase subunit V
  • Universal reference genes
AJ132229
  • F:GACCAAGGAGTGGCAGGAG
  • R: GAACTGGGTGGGAGGCAGCAGTTC
NA 60 NA

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: K. Bohle
  • Email: ibvt@tu-bs.de
  • Institution: Technische Universität Braunschweig, Institute of Biochemical Engineering, Gaußstraße 17, D-38106 Braunschweig, Germany

Citation Statistics

Cited by 35 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Bohle K, Jungebloud A, Göcke Y, et al. Selection of reference genes for normalisation of specific gene quantification data of Aspergillus niger[J]. Journal of biotechnology, 2007, 132(4): 353-358.
  2. Kelly JM, Hynes MJ. Transformation of Aspergillus niger by the amdS gene of Aspergillus nidulans. The EMBO Journal. 1985;4(2):475-479.

Categories