Difference between revisions of "Aspergillus niger"

From ICG
Jump to navigation Jump to search
Line 51: Line 51:
 
*'''Email''': ibvt@tu-bs.de
 
*'''Email''': ibvt@tu-bs.de
 
*'''Institution''': Technische Universität Braunschweig, Institute of Biochemical Engineering, Gaußstraße 17, D-38106 Braunschweig, Germany
 
*'''Institution''': Technische Universität Braunschweig, Institute of Biochemical Engineering, Gaußstraße 17, D-38106 Braunschweig, Germany
 +
===Citation Statistics===
 +
Cited by '''32''' (Based on Google Scholar [2017-06-16])
 +
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>

Revision as of 09:45, 17 June 2017

Description

Aspergillus niger Micrograph.jpg
  • Aspergillus niger is a fungus and one of the most common species of the genus Aspergillus.
  • Aspergillus niger is a member of the genus Aspergillus which includes a set of fungi that are generally considered asexual, although perfect forms (forms that reproduce sexually) have been found. Aspergilli are ubiquitous in nature.
  • Aspergillus niger grows poorly on acetamide as a nitrogen or carbon source and lacks sequences detectably homologous to the amdS gene encoding the acetamidase of Aspergillus nidulans[1][2].

Continuous Cultivations

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
act[1] Actin

Universal reference genes

AJ132229
  • F:GGTCTGGAGAGCGGTGGTAT
  • R:cactgcGAAGAAGGAGCAAGAGCAGtG
NA 60 NA
cox5[1] Cytochrome c oxidase subunit V

Universal reference genes

AJ132229
  • F:GACCAAGGAGTGGCAGGAG
  • R: gaactgGGTGGGAGGCAGCAGtTC
NA 60 NA

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: K. Bohle
  • Email: ibvt@tu-bs.de
  • Institution: Technische Universität Braunschweig, Institute of Biochemical Engineering, Gaußstraße 17, D-38106 Braunschweig, Germany

Citation Statistics

Cited by 32 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Bohle K, Jungebloud A, Göcke Y, et al. Selection of reference genes for normalisation of specific gene quantification data of Aspergillus niger[J]. Journal of biotechnology, 2007, 132(4): 353-358.
  2. Kelly JM, Hynes MJ. Transformation of Aspergillus niger by the amdS gene of Aspergillus nidulans. The EMBO Journal. 1985;4(2):475-479.