Aspergillus niger

From ICG
Jump to navigation Jump to search

Description

Continuous Cultivations

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
act[1] Actin

Universal reference genes

AJ132229
  • F:GGTCTGGAGAGCGGTGGTAT
  • R:cactgcGAAGAAGGAGCAAGAGCAGtG
NA 60 NA
cox5[1] Cytochrome c oxidase subunit V

Universal reference genes

AJ132229
  • F:GACCAAGGAGTGGCAGGAG
  • R: gaactgGGTGGGAGGCAGCAGtTC
NA 60 NA

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: K. Bohle
  • Email: ibvt@tu-bs.de
  • Institution: Technische Universität Braunschweig, Institute of Biochemical Engineering, Gaußstraße 17, D-38106 Braunschweig, Germany

References

  1. 1.0 1.1 Bohle K, Jungebloud A, Göcke Y, et al. Selection of reference genes for normalisation of specific gene quantification data of Aspergillus niger[J]. Journal of biotechnology, 2007, 132(4): 353-358.