Difference between revisions of "Bactrocera dorsalis"

From ICG
Jump to navigation Jump to search
Line 21: Line 21:
 
|align="center"| alpha tubulin
 
|align="center"| alpha tubulin
 
|
 
|
*female flies
+
*Female flies
* males files
+
* Males files
* fat body
+
* Fat body
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/GU269902 '''GU269902''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/GU269902 '''GU269902''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 35: Line 35:
 
|align="center"| clone BdA3
 
|align="center"| clone BdA3
 
|
 
|
* males files
+
* Males files
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12255 '''L12255''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12255 '''L12255''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 47: Line 47:
 
|align="center"| clone BdA5
 
|align="center"| clone BdA5
 
|
 
|
*female flies
+
*Female flies
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12256 '''L12256''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12256 '''L12256''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 59: Line 59:
 
|align="center"| clone BdA1
 
|align="center"| clone BdA1
 
|
 
|
*fat body
+
*Fat body
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12253 '''L12253''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12253 '''L12253''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 71: Line 71:
 
|align="center"| clone BdA2
 
|align="center"| clone BdA2
 
|
 
|
*both males and females
+
*Both males and females
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12254 '''L12254''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12254 '''L12254''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 80: Line 80:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
 +
 
===Moleculer Type===
 
===Moleculer Type===
 
* mRNA
 
* mRNA

Revision as of 02:31, 18 June 2017

Description

Bactrocera dorsalis-1.png
  • Bactrocera dorsalis is a species of tephritid fruit fly that is endemic to Southeast Asia, but has also been introduced to Hawaii, the Mariana Islands and Tahiti. It is one of the major pest species in the genus Bactrocera with a broad host range of cultivated and wild fruits.
  • The oriental fruit fly Bactrocera dorsalis (Hendel) (Diptera: Tephritidae) is a significant pest species that damages a wide range of fruit and other horticultural products, causing major financial losses to horticulture. Trichlorphon [dimethyl (2, 2, 2-trichloro-1-hydroxyethyl) phosphate] is a moderately toxic organophosphate insecticide that has been widely used to control this pest because of its low toxicity to humans and its high efficacy; however, resistance to this pesticide in B. dorsalis has been increasing, thus threatening the effective management of the oriental fruit fly.[1] [2].

Different Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
α-TUB[1] alpha tubulin
  • Female flies
  • Males files
  • Fat body
GU269902
  • F:CGCATTCATGGTTGATAACG
  • R:GGGCACCAAGTTAGTCTGGA
184 60 SYBR
ACT3[1] clone BdA3
  • Males files
L12255
  • F:GGTCGGTATGGGACAGAAGG
  • R: CTCACGATTGGCTTTTGGAT
220 60 SYBR
ACT5[1] clone BdA5
  • Female flies
L12256
  • F:CAACTCACCCGCAATGTATG
  • R:CGCTCAGCAGTGGTTGTAAA
237 60 SYBR
ACT1[1] clone BdA1
  • Fat body
L12253
  • F:AGCGTGAAATCGTGAGGGA
  • R:GACAAGACCGAGTTGGCATA
286 60 SYBR
ACT2 [1] clone BdA2
  • Both males and females
L12254
  • F:GTGTGATGGTTGGTATGGGA
  • R:GGCTGGGGAGTTGAAGGTTT
269 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Jin-Jun Wang
  • Email: jjwang7008@yahoo.com
  • Institution: Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 400715, P. R. China

Citation Statistics

Cited by 91 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Shen G M, Jiang H B, Wang X N, et al. Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae)[J]. BMC molecular biology, 2010, 11(1): 76.
  2. Cheng D, Guo Z, Riegler M, et al. Gut symbiont enhances insecticide resistance in a significant pest, the oriental fruit fly Bactrocera dorsalis (Hendel)[J]. Microbiome, 2017, 5(1): 13.