Difference between revisions of "Bactrocera dorsalis"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''''Different Tissues'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name !...")
 
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 +
 +
[[File:Bactrocera dorsalis-1.png|right|327px|]]
 +
* Bactrocera dorsalis is a species of tephritid fruit fly that is endemic to Southeast Asia, but has also been introduced to Hawaii, the Mariana Islands and Tahiti. It is one of the major pest species in the genus Bactrocera with a broad host range of cultivated and wild fruits.
 +
* Symbiotic bacteria affect insect physiology and ecology. They may also mediate insecticide resistance within their hosts and thereby impact pest and vector control practices. Here, we document a novel mechanism of insecticide resistance in which a gut symbiont of the tephritid pest fruit fly Bactrocera dorsalis enhances resistance to the organophosphate insecticide trichlorphon<ref name="ref1"/> <ref name="ref2"/>.
  
 
=='''''Different Tissues'''''==
 
=='''''Different Tissues'''''==

Revision as of 12:49, 16 June 2017

Description

Bactrocera dorsalis-1.png
  • Bactrocera dorsalis is a species of tephritid fruit fly that is endemic to Southeast Asia, but has also been introduced to Hawaii, the Mariana Islands and Tahiti. It is one of the major pest species in the genus Bactrocera with a broad host range of cultivated and wild fruits.
  • Symbiotic bacteria affect insect physiology and ecology. They may also mediate insecticide resistance within their hosts and thereby impact pest and vector control practices. Here, we document a novel mechanism of insecticide resistance in which a gut symbiont of the tephritid pest fruit fly Bactrocera dorsalis enhances resistance to the organophosphate insecticide trichlorphon[1] [2].

Different Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
α-TUB[1] alpha tubulin
  • female flies
  • males files
  • fat body
GU269902
  • F:CGCATTCATGGTTGATAACG
  • R:GGGCACCAAGTTAGTCTGGA
184 60 SYBR
ACT3[1] clone BdA3
  • males files
L12255
  • F:GGTCGGTATGGGACAGAAGG
  • R: CTCACGATTGGCTTTTGGAT
220 60 SYBR
ACT5[1] clone BdA5
  • female flies
L12256
  • F:CAACTCACCCGCAATGTATG
  • R:CGCTCAGCAGTGGTTGTAAA
237 60 SYBR
ACT1[1] clone BdA1
  • fat body
L12253
  • F:AGCGTGAAATCGTGAGGGA
  • R:GACAAGACCGAGTTGGCATA
286 60 SYBR
ACT2 [1] clone BdA2
  • both males and females
L12254
  • F:GTGTGATGGTTGGTATGGGA
  • R:GGCTGGGGAGTTGAAGGTTT
269 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Jin-Jun Wang
  • Email: jjwang7008@yahoo.com
  • Institution: Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 400715, P. R. China

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Shen G M, Jiang H B, Wang X N, et al. Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae)[J]. BMC molecular biology, 2010, 11(1): 76.
  2. Cite error: Invalid <ref> tag; no text was provided for refs named ref2