Difference between revisions of "Bactrocera dorsalis"

From ICG
Jump to navigation Jump to search
 
(10 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
+
[[File:Bactrocera dorsalis.png|right|200px|link=Bactrocera dorsalis]]
[[File:Bactrocera dorsalis.png|right|200px|]]
+
* '''''Bactrocera dorsalis''''' is a species of tephritid fruit fly that is endemic to Southeast Asia. Nowadays, it has also been introduced to Hawaii, the Mariana Islands and Tahiti. It is one of the major pest species in the genus Bactrocera with a broad host range of cultivated and wild fruits and other horticultural products, causing major financial losses to horticulture <ref name="ref1"/><ref name="ref2"/>.
* Bactrocera dorsalis is a species of tephritid fruit fly that is endemic to Southeast Asia, but has also been introduced to Hawaii, the Mariana Islands and Tahiti. It is one of the major pest species in the genus Bactrocera with a broad host range of cultivated and wild fruits.
 
* The oriental fruit fly Bactrocera dorsalis (Hendel) (Diptera: Tephritidae) is a significant pest species that damages a wide range of fruit and other horticultural products, causing major financial losses to horticulture. Trichlorphon [dimethyl (2, 2, 2-trichloro-1-hydroxyethyl) phosphate] is a moderately toxic organophosphate insecticide that has been widely used to control this pest because of its low toxicity to humans and its high efficacy; however, resistance to this pesticide in B. dorsalis has been increasing, thus threatening the effective management of the oriental fruit fly.<ref name="ref1"/> <ref name="ref2"/>.
 
 
* <font color=blue>'''Common Name:'''</font> '''Oriental fruit fly'''
 
* <font color=blue>'''Common Name:'''</font> '''Oriental fruit fly'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=27457 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=27457 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Sex & Tissues'''''==
 
=='''''Different Sex & Tissues'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 94: Line 92:
 
*'''Institution''': Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 400715, P. R. China
 
*'''Institution''': Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 400715, P. R. China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''91''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=16040388622197745956&as_sdt=2005&sciodt=0,5&hl=en '''98'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
Shen G M, Jiang H B, Wang X N, et al. Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae)[J]. BMC molecular biology, 2010, 11(1): 76.
+
Shen GM, Jiang HB, Wang XN, Wang JJ. Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly
 +
Bactrocera dorsalis (Diptera: Tephritidae). BMC Mol Biol. 2010 Oct 6;11:76. doi: 10.1186/1471-2199-11-76. PubMed PMID: 20923571.
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
Cheng D, Guo Z, Riegler M, et al. Gut symbiont enhances insecticide resistance in a significant pest, the oriental fruit fly Bactrocera dorsalis (Hendel)[J]. Microbiome, 2017, 5(1): 13.
+
Cheng D, Guo Z, Riegler M, Xi Z, Liang G, Xu Y. Gut symbiont enhances insecticide resistance in a significant pest, the oriental fruit fly Bactrocera dorsalis (Hendel). Microbiome. 2017 Feb 1;5(1):13. doi:10.1186/s40168-017-0236-z. PubMed PMID: 28143582.
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 
[[Category:Animals]] [[Category:mRNA]] [[Category:SYBR]]
 
[[Category:Animals]] [[Category:mRNA]] [[Category:SYBR]]
[[Category:ACT]] [[Category:ACT]] [[Category:ACT]] [[Category:ACT]] [[Category:Ubiquitin]]
+
[[Category:ACT]] [[Category:ACT]] [[Category:ACT]] [[Category:ACT]] [[Category:Tubulin]]
 
[[Category:Different Sex]]  [[Category:Different Tissues]]
 
[[Category:Different Sex]]  [[Category:Different Tissues]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 01:40, 11 September 2017

Description

Bactrocera dorsalis.png
  • Bactrocera dorsalis is a species of tephritid fruit fly that is endemic to Southeast Asia. Nowadays, it has also been introduced to Hawaii, the Mariana Islands and Tahiti. It is one of the major pest species in the genus Bactrocera with a broad host range of cultivated and wild fruits and other horticultural products, causing major financial losses to horticulture [1][2].
  • Common Name: Oriental fruit fly
  • NCBI Taxonomy

Different Sex & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
α-TUB[1] Alpha tubulin
  • Female flies
  • Males files
  • Fat body
GU269902
  • F:CGCATTCATGGTTGATAACG
  • R:GGGCACCAAGTTAGTCTGGA
184 60 SYBR
ACT3[1] Actin3
  • Males files
L12255
  • F:GGTCGGTATGGGACAGAAGG
  • R: CTCACGATTGGCTTTTGGAT
220 60 SYBR
ACT5[1] Actin5
  • Female flies
L12256
  • F:CAACTCACCCGCAATGTATG
  • R:CGCTCAGCAGTGGTTGTAAA
237 60 SYBR
ACT1[1] Actin1
  • Fat body
L12253
  • F:AGCGTGAAATCGTGAGGGA
  • R:GACAAGACCGAGTTGGCATA
286 60 SYBR
ACT2 [1] Actin2
  • Both males and females
L12254
  • F:GTGTGATGGTTGGTATGGGA
  • R:GGCTGGGGAGTTGAAGGTTT
269 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jin-Jun Wang
  • Email: jjwang7008@yahoo.com
  • Institution: Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 400715, P. R. China

Citation Statistics

Cited by 98 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Shen GM, Jiang HB, Wang XN, Wang JJ. Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae). BMC Mol Biol. 2010 Oct 6;11:76. doi: 10.1186/1471-2199-11-76. PubMed PMID: 20923571.
  2. Cheng D, Guo Z, Riegler M, Xi Z, Liang G, Xu Y. Gut symbiont enhances insecticide resistance in a significant pest, the oriental fruit fly Bactrocera dorsalis (Hendel). Microbiome. 2017 Feb 1;5(1):13. doi:10.1186/s40168-017-0236-z. PubMed PMID: 28143582.

Categories