Difference between revisions of "Bactrocera dorsalis"

From ICG
Jump to navigation Jump to search
 
(27 intermediate revisions by 8 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 +
[[File:Bactrocera dorsalis.png|right|200px|link=Bactrocera dorsalis]]
 +
* '''''Bactrocera dorsalis''''' is a species of tephritid fruit fly that is endemic to Southeast Asia. Nowadays, it has also been introduced to Hawaii, the Mariana Islands and Tahiti. It is one of the major pest species in the genus Bactrocera with a broad host range of cultivated and wild fruits and other horticultural products, causing major financial losses to horticulture <ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Oriental fruit fly'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=27457 <font color=blue>'''NCBI Taxonomy'''</font>]
  
−
[[File:Bactrocera dorsalis-1.png|right|327px|]]
+
=='''''Different Sex & Tissues'''''==
−
* Bactrocera dorsalis is a species of tephritid fruit fly that is endemic to Southeast Asia, but has also been introduced to Hawaii, the Mariana Islands and Tahiti. It is one of the major pest species in the genus Bactrocera with a broad host range of cultivated and wild fruits.
+
===Internal Control Genes===
−
* Symbiotic bacteria affect insect physiology and ecology. They may also mediate insecticide resistance within their hosts and thereby impact pest and vector control practices. Here, we document a novel mechanism of insecticide resistance in which a gut symbiont of the tephritid pest fruit fly Bactrocera dorsalis enhances resistance to the organophosphate insecticide trichlorphon<ref name="ref1"/> <ref name="ref2"/>.
 
−
 
 
−
=='''''Different Tissues'''''==
 
−
===Reference Genes===
 
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 13:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 19: Line 19:
 
|-
 
|-
 
|align="center"| α-TUB<ref name="ref1"/>
 
|align="center"| α-TUB<ref name="ref1"/>
−
|align="center"| alpha tubulin
+
|align="center"| Alpha tubulin
 
|
 
|
−
*female flies
+
*Female flies
−
* males files
+
* Males files
−
* fat body
+
* Fat body
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/GU269902 '''GU269902''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/GU269902 '''GU269902''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 33: Line 33:
 
|-
 
|-
 
|align="center"|  ACT3<ref name="ref1"/>
 
|align="center"|  ACT3<ref name="ref1"/>
−
|align="center"| clone BdA3
+
|align="center"| Actin3
 
|
 
|
−
* males files
+
* Males files
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12255 '''L12255''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12255 '''L12255''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 45: Line 45:
 
|-
 
|-
 
|align="center"| ACT5<ref name="ref1"/>
 
|align="center"| ACT5<ref name="ref1"/>
−
|align="center"| clone BdA5
+
|align="center"| Actin5
 
|
 
|
−
*female flies
+
*Female flies
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12256 '''L12256''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12256 '''L12256''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 57: Line 57:
 
|-
 
|-
 
|align="center"| ACT1<ref name="ref1"/>
 
|align="center"| ACT1<ref name="ref1"/>
−
|align="center"| clone BdA1
+
|align="center"| Actin1
 
|
 
|
−
*fat body
+
*Fat body
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12253 '''L12253''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12253 '''L12253''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 69: Line 69:
 
|-
 
|-
 
|align="center"| ACT2 <ref name="ref1"/>
 
|align="center"| ACT2 <ref name="ref1"/>
−
|align="center"| clone BdA2
+
|align="center"| Actin2
 
|
 
|
−
*both males and females
+
*Both males and females
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12254 '''L12254''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L12254 '''L12254''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 80: Line 80:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
−
===Moleculer Type===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 89: Line 91:
 
*'''Email''': jjwang7008@yahoo.com
 
*'''Email''': jjwang7008@yahoo.com
 
*'''Institution''': Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 400715, P. R. China
 
*'''Institution''': Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 400715, P. R. China
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=16040388622197745956&as_sdt=2005&sciodt=0,5&hl=en '''98'''] (Based on Google Scholar [2017-09-01])
 +
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
−
Shen G M, Jiang H B, Wang X N, et al. Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae)[J]. BMC molecular biology, 2010, 11(1): 76.
+
Shen GM, Jiang HB, Wang XN, Wang JJ. Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly
 +
Bactrocera dorsalis (Diptera: Tephritidae). BMC Mol Biol. 2010 Oct 6;11:76. doi: 10.1186/1471-2199-11-76. PubMed PMID: 20923571.
 +
</ref>
 +
<ref name="ref2">
 +
Cheng D, Guo Z, Riegler M, Xi Z, Liang G, Xu Y. Gut symbiont enhances insecticide resistance in a significant pest, the oriental fruit fly Bactrocera dorsalis (Hendel). Microbiome. 2017 Feb 1;5(1):13. doi:10.1186/s40168-017-0236-z. PubMed PMID: 28143582.
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 +
[[Category:Animals]] [[Category:mRNA]] [[Category:SYBR]]
 +
[[Category:ACT]] [[Category:ACT]] [[Category:ACT]] [[Category:ACT]] [[Category:Tubulin]]
 +
[[Category:Different Sex]]  [[Category:Different Tissues]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 01:40, 11 September 2017

Description

Bactrocera dorsalis.png
  • Bactrocera dorsalis is a species of tephritid fruit fly that is endemic to Southeast Asia. Nowadays, it has also been introduced to Hawaii, the Mariana Islands and Tahiti. It is one of the major pest species in the genus Bactrocera with a broad host range of cultivated and wild fruits and other horticultural products, causing major financial losses to horticulture [1][2].
  • Common Name: Oriental fruit fly
  • NCBI Taxonomy

Different Sex & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
α-TUB[1] Alpha tubulin
  • Female flies
  • Males files
  • Fat body
 GU269902
  • F:CGCATTCATGGTTGATAACG
  • R:GGGCACCAAGTTAGTCTGGA
 184 60 SYBR
ACT3[1] Actin3
  • Males files
 L12255
  • F:GGTCGGTATGGGACAGAAGG
  • R: CTCACGATTGGCTTTTGGAT
 220 60 SYBR
ACT5[1] Actin5
  • Female flies
 L12256
  • F:CAACTCACCCGCAATGTATG
  • R:CGCTCAGCAGTGGTTGTAAA
 237 60 SYBR
ACT1[1] Actin1
  • Fat body
 L12253
  • F:AGCGTGAAATCGTGAGGGA
  • R:GACAAGACCGAGTTGGCATA
 286 60 SYBR
ACT2 [1] Actin2
  • Both males and females
 L12254
  • F:GTGTGATGGTTGGTATGGGA
  • R:GGCTGGGGAGTTGAAGGTTT
 269 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jin-Jun Wang
  • Email: jjwang7008@yahoo.com
  • Institution: Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 400715, P. R. China

Citation Statistics

Cited by 98 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 1.5 Shen GM, Jiang HB, Wang XN, Wang JJ. Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae). BMC Mol Biol. 2010 Oct 6;11:76. doi: 10.1186/1471-2199-11-76. PubMed PMID: 20923571.
  2. ↑ Cheng D, Guo Z, Riegler M, Xi Z, Liang G, Xu Y. Gut symbiont enhances insecticide resistance in a significant pest, the oriental fruit fly Bactrocera dorsalis (Hendel). Microbiome. 2017 Feb 1;5(1):13. doi:10.1186/s40168-017-0236-z. PubMed PMID: 28143582.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Bactrocera_dorsalis&oldid=8891"